ID: 997346546

View in Genome Browser
Species Human (GRCh38)
Location 5:133196359-133196381
Sequence CCACTGGAGCAGAAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346539_997346546 3 Left 997346539 5:133196333-133196355 CCCGGAGCCTTTATGCAAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243
997346536_997346546 21 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243
997346541_997346546 -4 Left 997346541 5:133196340-133196362 CCTTTATGCAAGGTTCTGCCCAC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243
997346540_997346546 2 Left 997346540 5:133196334-133196356 CCGGAGCCTTTATGCAAGGTTCT 0: 1
1: 0
2: 1
3: 5
4: 112
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346546 Original CRISPR CCACTGGAGCAGAAGAATGA GGG Intergenic