ID: 997347119

View in Genome Browser
Species Human (GRCh38)
Location 5:133200042-133200064
Sequence TTGGAAATGATTATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997347115_997347119 11 Left 997347115 5:133200008-133200030 CCTGGATTTATGCTCTTGTAACA 0: 1
1: 0
2: 1
3: 9
4: 122
Right 997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG 0: 1
1: 1
2: 0
3: 32
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997347119 Original CRISPR TTGGAAATGATTATGGAGGA AGG Intronic
902056546 1:13605483-13605505 TTGGAGATGATAATTGAGCATGG + Intronic
902731528 1:18373098-18373120 CTGAAAATGACAATGGAGGAGGG - Intronic
903413908 1:23168581-23168603 TTGGAATGGATTTTGGAGGAAGG - Intronic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
906308073 1:44733740-44733762 GTGGAAATGATTTAGGAAGAAGG + Intergenic
906388804 1:45395780-45395802 TTGGAAATGATGCTATAGGAAGG - Intronic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
908351089 1:63286706-63286728 TCAGAAATGATCCTGGAGGATGG - Intergenic
908962835 1:69721370-69721392 TTGGCAGAGATTAGGGAGGATGG - Intronic
909678807 1:78268267-78268289 TTGAAAATGGTTATTGGGGATGG + Intergenic
910109338 1:83665990-83666012 TTGGAAATGATTGCAAAGGAAGG - Intergenic
910404402 1:86871961-86871983 TTTTAAAAGATTCTGGAGGAGGG + Intronic
910423256 1:87092617-87092639 TTGGAGATGATTATAGACCAGGG + Exonic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
912927178 1:113923600-113923622 TTAGAAATGATTATGGAGGAAGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
914706003 1:150170391-150170413 TTAGAATGGATAATGGAGGAGGG + Intergenic
916520786 1:165561668-165561690 TTTGTAATGATTACAGAGGAAGG - Intronic
916913856 1:169384539-169384561 TGGGAAATGATTCTTGAGAAGGG - Intronic
919322508 1:196061091-196061113 GTGGAAATGATTAGGCAGCAGGG - Intergenic
919343690 1:196347457-196347479 TAAGAATTGATGATGGAGGAAGG - Intronic
919543611 1:198883181-198883203 TTGGAAATAATTATGATGAAAGG + Intergenic
919570769 1:199244065-199244087 TTGGGAAAGATTGTGAAGGAAGG - Intergenic
920549125 1:206843710-206843732 TTTTAAATGATTATAGAGGCAGG - Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
924863059 1:247946728-247946750 CTGGGGGTGATTATGGAGGAGGG - Intronic
1063272948 10:4531893-4531915 TGAGAAATGATTTTGGAAGAAGG - Intergenic
1063508037 10:6619308-6619330 TTGTAAATGCCTATGGAGGATGG - Intergenic
1065440303 10:25746825-25746847 TGGGAAATGATTTTGGAGTCTGG + Intergenic
1069424152 10:68274928-68274950 TTGGAAACCATTTTGGAGGCAGG + Intergenic
1072455691 10:95573745-95573767 TGGGAAATGGACATGGAGGAGGG + Intergenic
1073638297 10:105221873-105221895 TTGGATTTGTTTATGTAGGAAGG + Intronic
1073932775 10:108595264-108595286 TTGGCAATGATTATTCAGTAAGG - Intergenic
1074579827 10:114708414-114708436 TTGGCAAGGAGCATGGAGGAAGG + Intergenic
1075246608 10:120828046-120828068 GGGGAAATGTTTCTGGAGGAAGG - Intergenic
1078078716 11:8186518-8186540 GGGGAAATGGTTATGGAGAAGGG - Intergenic
1078265310 11:9751334-9751356 TTTGAAAGGAGTATTGAGGAAGG + Exonic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1079192739 11:18294527-18294549 TTTGAAGAGATTATGGGGGAAGG + Intronic
1079840956 11:25398642-25398664 TTGGAATAGATAATGGAGGAAGG + Intergenic
1080228432 11:29987355-29987377 TTGCTAATGATTATGGGGAATGG + Intergenic
1080282542 11:30574879-30574901 TTGGAACTGAATTTGCAGGAGGG - Intronic
1080701189 11:34645645-34645667 TTGGGAATGATTTTACAGGATGG + Intronic
1080786362 11:35478501-35478523 TTGGAAATGTGTTTGGAAGAAGG + Intronic
1080879730 11:36308275-36308297 TAGAAATTGATTATTGAGGATGG + Intronic
1080956946 11:37108843-37108865 TTTGAAAGTATTATGGAGAATGG - Intergenic
1080969756 11:37258478-37258500 TTGGAAGTGTTGAAGGAGGAGGG + Intergenic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1084236008 11:67788406-67788428 CTGGAAATGCTTCTGGTGGATGG - Intergenic
1084384055 11:68831134-68831156 AAGGAATTGATTATGGAGAAAGG - Intronic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1084970174 11:72767194-72767216 ATGGTAATGGTTATGGAGGTTGG - Intronic
1086263233 11:84966495-84966517 TTGGAAAGTATTATAAAGGAAGG + Intronic
1087207925 11:95416856-95416878 TTGGGAATGATGGTGGAGGAAGG - Intergenic
1087427011 11:98002373-98002395 TATGAAAGGAGTATGGAGGAGGG + Intergenic
1087895768 11:103584122-103584144 TTTGAAATGTTTAAGGAGAAGGG - Intergenic
1087914903 11:103799041-103799063 TTGGAAGTGAGTATGTTGGATGG - Intergenic
1088234031 11:107703508-107703530 TTGGAAATGAGAGTGGAGGTAGG + Intergenic
1090314263 11:125771086-125771108 TTGCAAATGTTTTTAGAGGAGGG + Intergenic
1090367215 11:126216745-126216767 TTGGAAATGAGTATGGTGGTAGG - Intronic
1091003412 11:131930340-131930362 TTGAAAATAAGCATGGAGGAAGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093188851 12:16052095-16052117 TTCCAAATAATTAAGGAGGAGGG + Intergenic
1094028098 12:25980428-25980450 ACAGAAATGATTACGGAGGAAGG - Intronic
1094188481 12:27671233-27671255 AAGGAAATCATTCTGGAGGAAGG - Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095132405 12:38559959-38559981 TTTCACATGATTATGGAGGCTGG + Intergenic
1095790934 12:46166228-46166250 TTGGAGAGTATTATGGAAGAGGG + Intergenic
1095960518 12:47831910-47831932 TAGGTAATGATTATGTAGGGTGG + Intronic
1097945283 12:65360925-65360947 TTGGAAATGTTTAAGAGGGAAGG - Intronic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1100707630 12:97219147-97219169 TTAGAAGTGATGATGGAGGTGGG - Intergenic
1101241780 12:102846367-102846389 TTAGAAACGAGTATGAAGGAAGG + Intronic
1101533734 12:105598355-105598377 TTAGAAAATATTATTGAGGATGG + Intergenic
1103050643 12:117776525-117776547 TTGAAAAGGGTTATTGAGGATGG - Intronic
1104611926 12:130235787-130235809 TTGGAAAATATTTTGGAGTAGGG + Intergenic
1105470756 13:20692600-20692622 TAGGTAGTGATTATAGAGGAGGG + Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105796669 13:23860925-23860947 TAACAAATGATTATGGGGGAGGG + Intronic
1105876194 13:24555359-24555381 TAGGTTATGATTATGGAGCAAGG + Intergenic
1105946323 13:25192829-25192851 GTGGAAAACATTATGGTGGATGG + Intergenic
1107889848 13:44904595-44904617 TTGGTAATGAGTATGGAAGATGG - Intergenic
1108012638 13:46035515-46035537 TTGGTAATGAATATGTAGTACGG - Intronic
1108573411 13:51771405-51771427 TTGGAAATAATGATGCATGAAGG - Intronic
1109985896 13:69984399-69984421 TTGGCAATGAAAATGGAAGATGG - Intronic
1110050974 13:70898583-70898605 TTGGAAATGGTGGGGGAGGAGGG - Intergenic
1110506235 13:76290363-76290385 TTGGAAAGGGTGATGGAGGATGG + Intergenic
1111812164 13:93104676-93104698 ATGGAAATGGTTTTAGAGGAAGG + Intergenic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1113570829 13:111356041-111356063 TTGGAAATAATTTTGGAAGCTGG - Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1115095146 14:29626479-29626501 TTGGAATTGTTTATGGAGGTAGG - Exonic
1115310243 14:31972381-31972403 ATGGAAATGGTCATGGAAGAAGG - Intergenic
1115383933 14:32773590-32773612 TTTGAAATTATGATGGAAGAAGG + Intronic
1117771744 14:59140485-59140507 TTGTAAATTATTATTCAGGAAGG - Intergenic
1118514750 14:66514596-66514618 ATGGGAATGATTATAGGGGAGGG + Intronic
1118602244 14:67479110-67479132 TTAAAAATGCTTATGGAGGCTGG + Intronic
1118657204 14:67965441-67965463 TTTGACAAGAGTATGGAGGATGG - Intronic
1119038234 14:71248555-71248577 AAGGAAATCATTTTGGAGGAGGG + Intergenic
1120523543 14:85551788-85551810 ATGGAAAAGATTATGGAAAATGG - Intronic
1121063277 14:90937305-90937327 TTGGAATTGATAAGGGAGTAAGG + Intronic
1121146638 14:91589605-91589627 TTGGAAATTATCAACGAGGATGG - Exonic
1122004394 14:98690063-98690085 TTCAAAAAGATTACGGAGGAAGG + Intergenic
1202832292 14_GL000009v2_random:48406-48428 TGGGGAATGATAATGAAGGAAGG + Intergenic
1123849351 15:24339227-24339249 TTGCAAGTGATTATGGCTGATGG + Intergenic
1127877636 15:63124236-63124258 TTGGCTATGATTATAGAGCAAGG + Intronic
1128047283 15:64629801-64629823 TTGGAAGTTATGATGTAGGAAGG - Intronic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1128721407 15:69952719-69952741 TTGGAAATTTTTATGGGGCATGG - Intergenic
1131004325 15:88964516-88964538 TTAGAACTGATTATGGATGGAGG - Intergenic
1131706587 15:95002623-95002645 TTGGAAATAATTAAAGAGGCAGG - Intergenic
1134187279 16:12094563-12094585 TTGGAAGTGATCACGCAGGATGG + Intronic
1134350526 16:13433749-13433771 TTGGAACTGAGCTTGGAGGAAGG + Intergenic
1134839275 16:17388612-17388634 TTGGAAAGGATTATTGCGAAGGG + Intronic
1135968249 16:27053122-27053144 TTGGAAAGGATTTTGGTGGCAGG - Intergenic
1136495418 16:30640394-30640416 CTGCAAATGATGGTGGAGGAGGG + Intergenic
1137014235 16:35358082-35358104 GTTGAAAAGTTTATGGAGGAAGG + Intergenic
1137937468 16:52648290-52648312 TTCTAACTAATTATGGAGGAAGG - Intergenic
1138845846 16:60564767-60564789 CTGGGAATAAATATGGAGGAGGG + Intergenic
1139762890 16:69201441-69201463 ATGGAAAGGATTAGGGAGGCGGG + Intronic
1140055478 16:71521940-71521962 CTGGAAATGTTTAGGAAGGAGGG - Intronic
1141382184 16:83586342-83586364 TTGAAAATGGCTCTGGAGGAGGG + Intronic
1142881562 17:2885918-2885940 CTGGAAATGATTCGGCAGGAAGG + Intronic
1144382021 17:14709230-14709252 TTGGAAATAGATATTGAGGAAGG + Intergenic
1144741867 17:17588295-17588317 TTGGAAACGATTTTGGATAAAGG + Intronic
1147775884 17:42900865-42900887 AAGGAAATGAGGATGGAGGAAGG + Exonic
1148235093 17:45963562-45963584 TTAGAAATGGGTATGGAGGCAGG - Intronic
1148853197 17:50564769-50564791 TTGGAAATTAAATTGGAGGAGGG - Intronic
1150119251 17:62585862-62585884 TGGGAAATGATTCTGAAGGCAGG + Intronic
1153329739 18:3861820-3861842 TTGGAAAAGCTTATTGAGGCAGG - Intronic
1155288750 18:24319813-24319835 CTGGAACTGTTTATGCAGGAAGG + Intronic
1155493009 18:26418222-26418244 TTAGCAATGATTGGGGAGGAAGG - Intergenic
1155831485 18:30520626-30520648 TTGAAATGGATTTTGGAGGAAGG + Intergenic
1156245387 18:35292790-35292812 TTGGAATAGATTATTAAGGAAGG - Intergenic
1157836938 18:50912974-50912996 TTGTAAATGATTATTGAATAAGG + Intronic
1157959100 18:52132412-52132434 TGGGAAATGATTATAGAGCATGG + Intergenic
1159424254 18:68263983-68264005 TTGGAAAAGATTTTGGTGGCTGG - Intergenic
1159740689 18:72166198-72166220 CTAGAAATGATTTGGGAGGAAGG + Intergenic
1159767783 18:72510597-72510619 GTGGAAATGATTTTGGAGCTAGG - Intergenic
1161761168 19:6173654-6173676 TTTGAACTGAAAATGGAGGAAGG - Intronic
1162179754 19:8860119-8860141 TTGGAAAGTTTTATGTAGGAAGG - Intronic
1162243613 19:9379851-9379873 TTAGAAAGGATTGTGGAGGTTGG - Intronic
1162681561 19:12347375-12347397 TTGGAAACCATTATGGAGTGAGG + Intergenic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1164830897 19:31319906-31319928 TTGGAAAGAATTAGGAAGGAAGG - Intronic
1165354449 19:35295076-35295098 GTGGAAATGGTTGTGGAGGTGGG - Intronic
1165691106 19:37863996-37864018 TTGGAAAAAGTTTTGGAGGAAGG - Intergenic
1167323082 19:48808047-48808069 TTGGCACTGATTCTGGAAGATGG + Intronic
1167512051 19:49900582-49900604 TCAGAAATGATTCTGGAGGCTGG - Intronic
1202640391 1_KI270706v1_random:79366-79388 TGGGGAATGATAATGAAGGAAGG - Intergenic
925335248 2:3094283-3094305 TTGAAAATGATCATGTAGTAAGG + Intergenic
926243789 2:11107204-11107226 TTTGAAATGATTAAGGAGGTGGG + Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
927334853 2:21909919-21909941 TTGCAAACCATTATGGAGTAAGG - Intergenic
928485280 2:31724719-31724741 TTGGAAAAGATGTTGGAGGAAGG + Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929901164 2:46005032-46005054 TTGGGTATGATGATGGGGGAGGG - Intronic
930900347 2:56499116-56499138 TTCGAAAAGATTGAGGAGGAGGG - Intergenic
930972849 2:57418693-57418715 TTAGAAATTATTCTGGAGGAGGG + Intergenic
931764401 2:65442095-65442117 TTGGAAATGATGGTGGTGGAAGG + Intergenic
933228083 2:79773990-79774012 TTGCAAAAGATCATGGGGGAAGG - Intronic
935988824 2:108700709-108700731 TTGGAAATGGATATTGATGATGG + Intergenic
939447289 2:142326300-142326322 TTGGAAATGATTCTGTTGTAAGG + Intergenic
939514942 2:143154670-143154692 TTGAAGAGGATTATGGATGAGGG + Intronic
940329377 2:152457869-152457891 TTTGCATTGAATATGGAGGAAGG - Intronic
940440224 2:153706538-153706560 CTGGAAATGATTGAGGAGTAGGG - Intergenic
942432509 2:175927878-175927900 TTTGAAAGAAATATGGAGGAAGG - Exonic
943151713 2:184122197-184122219 TTGGAGATGTTTAAGGATGATGG - Intergenic
943246161 2:185453563-185453585 TTGCAAAAAATTAAGGAGGAGGG + Intergenic
944338482 2:198566182-198566204 TTTGAAAAAATTAAGGAGGAGGG - Intronic
944505911 2:200410553-200410575 TTGGACATGATTAGGGAGGGAGG - Intronic
944754560 2:202746849-202746871 TTGCAAACAATTATAGAGGAAGG + Intronic
945270944 2:207939456-207939478 TGGGAAACGGTTATGGATGAAGG + Intronic
945325546 2:208478424-208478446 TTGGCTTTGATGATGGAGGAAGG - Intronic
945329999 2:208528640-208528662 CTGGAAATGATTAAGGAAGCAGG + Intronic
947299174 2:228668973-228668995 TTCGAAAGAATTATGGGGGAGGG + Intergenic
948355713 2:237375324-237375346 CTGGCAATGAGGATGGAGGATGG + Intronic
1170419004 20:16173862-16173884 TTGGAATTGTTTAGGGAGCAGGG + Intergenic
1171887274 20:30666090-30666112 TGGGGAATGATAATGAAGGAAGG - Intergenic
1173054455 20:39597635-39597657 TTGGAAAAGTTTATGGATCATGG + Intergenic
1174264599 20:49322267-49322289 TTGGAAATGATTGGTGAGGATGG + Intergenic
1175280237 20:57799345-57799367 TTGGAAATTATTCTGTAGGAGGG + Intergenic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176648718 21:9376957-9376979 TGGGGAATGATAATGAAGGAAGG - Intergenic
1176691949 21:9923470-9923492 TTATAAATGACAATGGAGGATGG - Intergenic
1177144623 21:17393962-17393984 TAGGGAATGATTAAGTAGGATGG - Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1178611220 21:34082628-34082650 TTGGTAAAGATTATAGAGGAGGG + Intronic
1178856467 21:36254379-36254401 TGGGAAAGGATGAGGGAGGAGGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179387088 21:40954000-40954022 TTGGATATGTTTGTGGAGGAAGG - Intergenic
1180361552 22:11902515-11902537 TGGGGAATGATAATGAAGGAAGG + Intergenic
1182845966 22:33431124-33431146 GTGGCAATGAGGATGGAGGAGGG + Intronic
1182942895 22:34294951-34294973 ATGGAACTTATAATGGAGGAAGG + Intergenic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949092253 3:42124-42146 TTGGTTTTGATGATGGAGGAAGG - Intergenic
949263794 3:2134073-2134095 TTGGAAAAGACTATGGAGTCAGG + Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951843031 3:27055013-27055035 TTCCAAAAGATTATGGAAGAGGG - Intergenic
953121683 3:40049679-40049701 TTAGAAATGATTAGTGAGGAAGG + Intronic
953250158 3:41238504-41238526 TGGGTAATGAACATGGAGGATGG + Intronic
956076002 3:65506376-65506398 AGGGAAATGGTTATGGAAGAAGG + Intronic
956368677 3:68534305-68534327 TTGGAACAGGTTATGGAAGAAGG - Intronic
956925875 3:73987826-73987848 TTGGAAATCATTATGAAGAGTGG + Intergenic
957461818 3:80532039-80532061 TTGCCAATGATTAAGGGGGAAGG + Intergenic
957690795 3:83564399-83564421 TTATAAATGATTATCCAGGATGG + Intergenic
957977393 3:87464618-87464640 TTCCAAAAGATTAAGGAGGAGGG + Intergenic
958253579 3:91298815-91298837 TTGGAGATGATTGTGGAGGCTGG - Intergenic
960329008 3:116334332-116334354 TTGGAAATGTTTGAGAAGGACGG - Intronic
960535607 3:118811686-118811708 TGGGAGATGATTGTGGATGAAGG - Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
966261173 3:177981271-177981293 TTGGGAGTGATTAAGGTGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
1202738162 3_GL000221v1_random:28036-28058 TGGGGAATGATAATGAAGGAAGG + Intergenic
969044351 4:4325945-4325967 TTGGAAATGATTCTATAGGTTGG + Intergenic
970158802 4:13168655-13168677 TTTGAAAGGATTTGGGAGGATGG - Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
970997096 4:22280059-22280081 TTGGAATTAATTACAGAGGAAGG + Intergenic
971886549 4:32456799-32456821 TTGCTCATGATTCTGGAGGATGG - Intergenic
972089095 4:35257761-35257783 GTGGAAATGGTTATGGCGAAGGG + Intergenic
972895821 4:43619077-43619099 TTGTAAAAAATTATGGAGGAGGG + Intergenic
973226822 4:47794843-47794865 TTGGAAATGATTATCTTGGTTGG - Intronic
973319077 4:48791487-48791509 TTGGAAAAGATCATGGACTAGGG - Intergenic
973383906 4:49489875-49489897 TGGGGAATGATAATGAAGGAAGG - Intergenic
975071923 4:70151779-70151801 TTGGAAATTATGATGAAGAAAGG - Intronic
975455820 4:74588826-74588848 ATAGAAATGAGTATGGAGGCAGG + Intergenic
976145783 4:82041920-82041942 TTGGAAATGAATATTTAGAAAGG + Intronic
976362956 4:84202306-84202328 TTAGAAATGAAACTGGAGGAAGG + Intergenic
977692523 4:99930594-99930616 TTGGAAATAATTATGAAAAATGG - Exonic
977712163 4:100138795-100138817 TAGGATGTGATTATGAAGGAGGG - Intergenic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978388962 4:108204335-108204357 TTAGAAATGAGTTTGGAGTAGGG + Intergenic
978578155 4:110206541-110206563 GTGGACATGAATTTGGAGGAAGG + Intergenic
979980728 4:127251804-127251826 TTGGAAATCATTATCTAGAAGGG - Intergenic
980364544 4:131783661-131783683 TTATAAATGACAATGGAGGATGG - Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
982242170 4:153311252-153311274 ATGGACATGATGTTGGAGGAGGG - Intronic
984586306 4:181568754-181568776 TTGGAAAGGATTAGGGAAGTGGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986733395 5:10651191-10651213 TTGGAACTGAGCCTGGAGGAGGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987743516 5:21940321-21940343 TTGGATATCATTCTGGAGGGTGG + Intronic
988159442 5:27501220-27501242 TCAGAGCTGATTATGGAGGAGGG - Intergenic
988222780 5:28370751-28370773 TTGAAAATAATTGTGGAGGCTGG + Intergenic
989441545 5:41477614-41477636 TTGGAAGTGACTATGGTGTAAGG - Intronic
990834832 5:60006124-60006146 TTGAAAATAATTGTAGAGGAAGG + Intronic
991763714 5:69950457-69950479 TTGGATATCATTCTGGAGGGTGG + Intergenic
991783611 5:70167669-70167691 TTGGATATCATTCTGGAGGGTGG - Intergenic
991842945 5:70825525-70825547 TTGGATATCATTCTGGAGGGTGG + Intergenic
991876056 5:71168012-71168034 TTGGATATCATTCTGGAGGGTGG - Intergenic
994055314 5:95407701-95407723 TTGGAAATGAGCCTGAAGGAGGG - Intronic
994561588 5:101380726-101380748 TTAGAAAAAATTAAGGAGGAGGG - Intergenic
994877403 5:105442562-105442584 TTGGAAATAATTCTGTAGGTGGG + Intergenic
996245885 5:121263422-121263444 TTGGCAATGGTTATGCAGAAGGG + Intergenic
996261430 5:121474661-121474683 ATAGAAATAATTATGGAGAATGG + Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998878821 5:146626953-146626975 ATGGAAATGAGGATGGAAGAAGG + Intronic
998995022 5:147862111-147862133 TTGGAGATGACTCTAGAGGAAGG + Intergenic
1000494022 5:161955546-161955568 TTTGAAATGTATCTGGAGGAAGG - Intergenic
1002756906 6:170957-170979 TTGGGCATGATCATGAAGGAAGG - Intergenic
1003481674 6:6539726-6539748 GTGGAATTGATTATGGTGTATGG + Intergenic
1003670505 6:8153615-8153637 TAGGAAATGACTATGGTGTATGG + Intergenic
1004636225 6:17470593-17470615 TTGGAAAAGAGAATGCAGGAAGG + Intronic
1005395103 6:25373876-25373898 TTAGAAATGAAAATGGAGGCCGG - Intronic
1006715771 6:36119209-36119231 CTGGAAATGATTGTGGCTGAAGG - Intergenic
1007202147 6:40118731-40118753 TTGGTCATGATGATGGTGGAAGG - Intergenic
1007871464 6:45044192-45044214 TTGGAAATGATAATAGAGATTGG - Intronic
1009190892 6:60628213-60628235 TTGCAGATGATTGTGGAGGCTGG + Intergenic
1009911822 6:69939139-69939161 TTGAAAAAGATTTTTGAGGAGGG + Intronic
1011814987 6:91179028-91179050 TAGAAAAGGATTATGTAGGAAGG - Intergenic
1013098585 6:106968423-106968445 ATGGAATTGATAATGGAAGAAGG + Intergenic
1013423031 6:109983367-109983389 TTTTCAATGATTATGGAGGCTGG - Intergenic
1014072501 6:117199283-117199305 TTTTCATTGATTATGGAGGAAGG - Intergenic
1014141499 6:117948742-117948764 GTGGAAATGACTATTGAGAAGGG + Intronic
1014340379 6:120198025-120198047 ATAGAAATGATTATGGAGACTGG - Intergenic
1014734345 6:125074680-125074702 TGGTCAATGATTATGGAGGTGGG - Intronic
1016293384 6:142548369-142548391 TTGCAAATGATTATGAAGAACGG - Intergenic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1018115504 6:160579708-160579730 TTGGAACGTATTATGGAGCATGG + Intronic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021461318 7:20890269-20890291 TTGGCAAAGATTGTGCAGGAAGG - Intergenic
1021673818 7:23060433-23060455 GAGGAAATGATAATGGGGGAAGG + Intergenic
1023686337 7:42739280-42739302 TTGGCTTTGATGATGGAGGAAGG - Intergenic
1024602579 7:50996863-50996885 TTGGCAAAGACTATGGAGAAAGG + Intergenic
1026280675 7:68919248-68919270 CTAGAAATTATTATGGAAGAAGG - Intergenic
1026374712 7:69738862-69738884 TTGGTAATCAGTGTGGAGGAAGG + Intronic
1028219926 7:88185171-88185193 TTGGCAATGATTATGGCTAAAGG + Intronic
1028452720 7:91003831-91003853 TAGAAAATGATTATGGGGGCAGG + Intronic
1028480513 7:91299649-91299671 TTGAGAGTGATTATTGAGGATGG - Intergenic
1028825079 7:95262907-95262929 TTAGACACGGTTATGGAGGAAGG - Intronic
1029790116 7:102834019-102834041 TTGGAAACCATGATGAAGGAAGG + Intronic
1030115374 7:106058762-106058784 ATGGAAGTCAGTATGGAGGATGG - Intergenic
1030363625 7:108622124-108622146 ATGGAAATGATTGTTAAGGAAGG + Intergenic
1030392928 7:108949583-108949605 ATGGAAATGCTTATGCAGCATGG + Intergenic
1032769311 7:135033109-135033131 TTAGAAATTGTTGTGGAGGAGGG + Intronic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1033785613 7:144726901-144726923 TTGGCTATGATTATAGAGCAAGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034736690 7:153435367-153435389 TTGGAAATAATTAATAAGGAAGG + Intergenic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037521395 8:19683503-19683525 TTAGAAAAGATTGTGGAAGAGGG + Intronic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1039013504 8:33121821-33121843 ATGAAAATGATATTGGAGGAAGG - Intergenic
1039525362 8:38209855-38209877 TTGCAAATGATTAAGGAGAGGGG + Intronic
1039666654 8:39540677-39540699 TGGGAAATGCTTGAGGAGGAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1044512263 8:93096088-93096110 ATGGAAATGCTTATGTAGTAAGG - Intergenic
1044570124 8:93708911-93708933 TTGGAAATGACTAAGGAGAGTGG - Intronic
1047126143 8:121962970-121962992 CTAGAAATGATTATGGAAGGTGG - Intergenic
1047622018 8:126617665-126617687 TTGGAAATGTCATTGGAGGAAGG + Intergenic
1047972220 8:130095048-130095070 TTTGAAATGATTCAGGAGGTTGG - Intronic
1048622270 8:136147160-136147182 TTCTAAATGATTATGGAAGATGG - Intergenic
1050452021 9:5791979-5792001 TTGGAAATGATGGGAGAGGAGGG + Intronic
1050475889 9:6040813-6040835 TTCCAAATGATTATGGAAGAAGG - Intergenic
1052666757 9:31504680-31504702 TAGGAATGGATTATGGAGGCTGG - Intergenic
1053182115 9:35981613-35981635 TTGGAAAACATTAGAGAGGAAGG + Intergenic
1053245597 9:36532198-36532220 TTTGATATAATTCTGGAGGAGGG + Intergenic
1054364552 9:64321699-64321721 TTATAAATGACAATGGAGGATGG - Intergenic
1055361540 9:75496297-75496319 TTGGAAATGAGTTTACAGGATGG - Intergenic
1055406552 9:75979804-75979826 TAGAAAGTGATTATGGAGGAAGG - Intronic
1055969698 9:81899615-81899637 TGAGAAATGAATATGGTGGATGG + Intergenic
1056016706 9:82396444-82396466 TTGGTAGTAATTATGGTGGAAGG + Intergenic
1057011556 9:91607139-91607161 TTAAAAATCATTATGGAGGCTGG + Intronic
1057733190 9:97629898-97629920 TTGGAAAAGATGCTGGAGGTGGG - Intronic
1059226125 9:112674787-112674809 TGGAAACTGATTTTGGAGGAAGG - Intergenic
1059564430 9:115369270-115369292 TTGGAAGTGGTGATGGAGAATGG - Intronic
1059579858 9:115532898-115532920 TTGTAAATGCTTATGTAGTAAGG + Intergenic
1059686905 9:116646543-116646565 CTGGAAATGATCCTGGAGGAAGG - Intronic
1059799585 9:117736808-117736830 TAGAAAATGAATATGGAGCAAGG - Intergenic
1059873493 9:118604438-118604460 TTGGAAATTGTTGAGGAGGAGGG + Intergenic
1203692167 Un_GL000214v1:54131-54153 TGGGGAATGATAATGAAGGAAGG - Intergenic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1203706892 Un_KI270742v1:58480-58502 TGGGGAATGATAATGAAGGAAGG + Intergenic
1203548514 Un_KI270743v1:150032-150054 TGGGGAATGATAATGAAGGAAGG - Intergenic
1203556355 Un_KI270744v1:1024-1046 TGGGGAATGATAATGAAGGAAGG - Intergenic
1203644128 Un_KI270751v1:50060-50082 TGGGGAATGATAATGAAGGAAGG + Intergenic
1186028635 X:5342520-5342542 TTAAAAATGTTTATGGAGGCCGG + Intergenic
1186151702 X:6681382-6681404 TTGGAAGGGAATATGGAGGTGGG - Intergenic
1186851971 X:13589369-13589391 TTGAAACTAATTATTGAGGAAGG + Intronic
1188694021 X:33166050-33166072 TTGGAAAGGATGCTGAAGGAAGG + Intronic
1188711584 X:33406860-33406882 TTCCAAATGATTGAGGAGGAAGG - Intergenic
1189642410 X:43087040-43087062 TTGGGCATGATTATGGAGTGTGG - Intergenic
1190328813 X:49223271-49223293 TTAGAAATGATTTTGGAGTTGGG + Intronic
1190618808 X:52264927-52264949 TTGGAAAGGAGTAGGGAGGTGGG + Intergenic
1190625808 X:52337454-52337476 TTGGAAAGGAGTAGGGAGGTGGG - Intergenic
1191823948 X:65343282-65343304 TTCAAAATAATTAAGGAGGAGGG + Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193074918 X:77345536-77345558 TGGGAAATGTTTCTGGAGAAAGG - Intergenic
1193536621 X:82724461-82724483 TTTGAATTGCTTGTGGAGGAGGG + Intergenic
1194166236 X:90520935-90520957 ATTGAAATAATTTTGGAGGATGG - Intergenic
1194708879 X:97208996-97209018 TTAGAAATGATTATGTAGTAAGG - Intronic
1196081334 X:111636145-111636167 TTTAAAATAATTATAGAGGAAGG - Intergenic
1198065455 X:133091999-133092021 TTGGAACTCATTTTGGTGGATGG + Intronic
1200512505 Y:4098716-4098738 ATTGAAATAATTTTGGAGGATGG - Intergenic
1202104558 Y:21349111-21349133 TTGGAAAAGTTTATCGAGGCCGG + Intergenic