ID: 997351417

View in Genome Browser
Species Human (GRCh38)
Location 5:133233943-133233965
Sequence GGGTTAGCTGACTTTCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997351413_997351417 -3 Left 997351413 5:133233923-133233945 CCAGGCCTTGTTTAGAGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 157
997351405_997351417 24 Left 997351405 5:133233896-133233918 CCTGATGAGCAGCTCTGTTTCCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 157
997351409_997351417 4 Left 997351409 5:133233916-133233938 CCGGAGGCCAGGCCTTGTTTAGA 0: 1
1: 0
2: 21
3: 81
4: 258
Right 997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 157
997351415_997351417 -8 Left 997351415 5:133233928-133233950 CCTTGTTTAGAGCGGGGGTTAGC 0: 1
1: 0
2: 1
3: 4
4: 29
Right 997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997351417 Original CRISPR GGGTTAGCTGACTTTCTTAA GGG Intronic
900724259 1:4204944-4204966 AAGTTAGCTGAAATTCTTAAAGG + Intergenic
908479680 1:64526192-64526214 GTGTAAGCTGTCTTTTTTAAAGG + Intronic
909614418 1:77590555-77590577 GGCTTGGCAAACTTTCTTAAAGG - Intronic
911327790 1:96489674-96489696 GGGTTCTCTGTCTCTCTTAATGG - Intergenic
912047440 1:105477208-105477230 GTTTTTGTTGACTTTCTTAATGG + Intergenic
913588012 1:120295315-120295337 GTGTTAGGTGAGTCTCTTAAAGG + Intergenic
913620173 1:120603054-120603076 GTGTTAGGTGAGTCTCTTAAAGG - Intergenic
913701406 1:121377782-121377804 TGATTTCCTGACTTTCTTAAGGG - Intronic
914041962 1:144058243-144058265 TGATTTCCTGACTTTCTTAAGGG - Intergenic
914136127 1:144902244-144902266 TGATTTCCTGACTTTCTTAAGGG + Intronic
914570028 1:148907188-148907210 GTGTTAGGTGAGTCTCTTAAAGG + Intronic
914602801 1:149223081-149223103 GTGTTAGGTGAGTCTCTTAAAGG - Intergenic
919397775 1:197071857-197071879 GTGTTAGGTGAGTCTCTTAAAGG - Intergenic
920213510 1:204345845-204345867 GGGTGAGCTGATTTTCTCCAGGG - Intronic
920715962 1:208340510-208340532 GGTTTAAATAACTTTCTTAAGGG - Intergenic
921786081 1:219231044-219231066 GAGTTAGCTGTCATTGTTAATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923458934 1:234190313-234190335 GTGTTAGGTGAGTCTCTTAAAGG - Intronic
1062901235 10:1148318-1148340 GGGTTGTCAAACTTTCTTAAAGG + Intergenic
1063445459 10:6111688-6111710 AGATTAGCTGACTAGCTTAAGGG - Intronic
1066221845 10:33342862-33342884 GGGTTAGTTGACTATGTTATTGG - Intergenic
1067819314 10:49513277-49513299 GAGCTAGCTGACTTTCCTTAAGG - Intronic
1068055099 10:52003213-52003235 AGGTTAATTCACTTTCTTAAGGG - Intronic
1068293359 10:55033906-55033928 GGATTAGATGTCTTTATTAAAGG + Intronic
1069271869 10:66538860-66538882 GGTTTAACTGATTTTCATAATGG + Intronic
1069930500 10:71878517-71878539 GGGTTGGCTGACTCTCTGAGAGG + Intergenic
1071333658 10:84584895-84584917 GGGTTTGCAAACATTCTTAAAGG + Intergenic
1072769622 10:98126568-98126590 GAGTCTGCTTACTTTCTTAATGG - Intergenic
1074349405 10:112721103-112721125 AGGTTAGCTCACTTTTTCAATGG + Intronic
1074415847 10:113265924-113265946 GGGGTCGCTGACTTTATCAACGG + Intergenic
1076372053 10:129961793-129961815 GAGTTAGCTGCCTTTGTTATAGG + Intronic
1076657572 10:132035219-132035241 TGGTTACCTCACTTCCTTAAAGG - Intergenic
1078783903 11:14468395-14468417 AGGTTAGCTGAGGTTTTTAAAGG - Intronic
1078823817 11:14907464-14907486 GGATTAACTGACTTGCCTAAAGG + Intronic
1080510742 11:32967703-32967725 AGGTTAAGTGACTTGCTTAAGGG + Intronic
1085422274 11:76372983-76373005 AGGTTAGCTAACTTTTTTAAAGG - Intronic
1090368735 11:126230436-126230458 GGGTTAACTTCATTTCTTAAGGG - Intronic
1093182084 12:15978093-15978115 GTGTCAGCTGAGTTTGTTAAAGG + Intronic
1094335582 12:29347269-29347291 GGGATGGCTCACTTTCCTAATGG - Intronic
1094637857 12:32244321-32244343 GGGTCAGCTTATTTTCATAAGGG - Intronic
1096334761 12:50745303-50745325 GGGTTATCTGATTTGCTTATGGG - Exonic
1101412955 12:104484343-104484365 GGGTTAACTGGGGTTCTTAATGG - Intronic
1105314684 13:19246470-19246492 GTGTTAGGTGAGTTTCTTGAAGG - Intergenic
1106426293 13:29633582-29633604 GGGTTCACTGATTTTTTTAAAGG + Intergenic
1106885545 13:34181001-34181023 GGGTTAGCTGATCTTCAAAAAGG - Intergenic
1108261821 13:48665703-48665725 AGGTTAGGTGATTTTCTTATAGG + Intronic
1108993353 13:56693480-56693502 GGGTTAGCTGGGTTTCTCAGAGG - Intergenic
1109618085 13:64863191-64863213 GTGTTAGTTGACTCTCTTGAAGG + Intergenic
1110175195 13:72547961-72547983 GGATTAGCTGTCTTTCTTTGGGG - Intergenic
1111409365 13:87854293-87854315 TGGGTAGCTGAGTTCCTTAATGG - Intergenic
1112779263 13:102880184-102880206 GAGTTAGCTGAGTTTCTAGAAGG - Intergenic
1118890181 14:69902579-69902601 GGGCTAGATGGTTTTCTTAAAGG - Intronic
1121997254 14:98612829-98612851 GCTTTAGCTGACTTTCCAAAGGG - Intergenic
1124845274 15:33283828-33283850 GGGAAAGCTGACTTTCTGACAGG - Intergenic
1126961391 15:54000293-54000315 AGGTTACTTGACTTGCTTAAGGG - Intergenic
1137958957 16:52862304-52862326 AGGTCAGCTGATTATCTTAATGG - Intergenic
1141301182 16:82816988-82817010 GGGATAGCTCCCTTTCCTAAGGG - Intronic
1141933930 16:87223892-87223914 GTGTTAGCTGGTTTTTTTAAAGG - Intronic
1152176995 17:78794416-78794438 GGGTGAGGTGACATTCTGAAAGG - Intronic
1152263531 17:79280026-79280048 GGGTGTGGTGACATTCTTAATGG - Intronic
1152518835 17:80843495-80843517 GGGCTAATTGACTTTCTTAGGGG + Intronic
1153079719 18:1208624-1208646 GGGTTAGTTGAGTCTCTTGAAGG + Intergenic
1153164466 18:2246200-2246222 GGGTTAGGTGAGTCTCTGAAAGG - Intergenic
1154933098 18:21021168-21021190 GTGTTGGCTGTCTTTCATAATGG - Intronic
1155046603 18:22108835-22108857 TGGTGAGCTCACTTTATTAAGGG - Intergenic
1156706719 18:39891239-39891261 AGGTTTGATGACTTTCTGAAAGG - Intergenic
1158369994 18:56789800-56789822 GGCGTAGCTGACTTTCTTAGAGG + Intronic
1161235887 19:3198039-3198061 GGGCCAGCAGACTTTCATAAAGG - Intronic
1162855994 19:13469081-13469103 GGCTTTGCTGACTTTCTTGGGGG - Intronic
1162916867 19:13879285-13879307 CTGTTAGCTGACTTCCTCAAAGG - Intronic
1164018169 19:21271495-21271517 GTGTTAGATGAGTTTCTTGAAGG + Intronic
1168458224 19:56532004-56532026 GGGTTAGGTGAGTGTCATAAAGG + Intergenic
925684972 2:6460859-6460881 GGTTTAGATGAATTTATTAAAGG - Intergenic
926079132 2:9969724-9969746 TGGGTAGCTGACTCTCTCAAAGG - Intronic
927441199 2:23119291-23119313 GGGTCAGCAAACTTTCTTAAAGG - Intergenic
929423093 2:41815227-41815249 GAGGTAGCTGAATTTCTTATTGG + Intergenic
930286944 2:49442107-49442129 GTATCAGCTGACTTTCTAAAAGG + Intergenic
931651245 2:64470934-64470956 TGGTTAGGTGACTTTGTCAATGG + Intergenic
935535368 2:104287047-104287069 GGGTTGGCTGCATTTCTTTACGG - Intergenic
935752981 2:106255043-106255065 TGTTTAGCTGACTTTTTTCAGGG + Intergenic
937183788 2:120019975-120019997 GGGTTAGCTTATTTTTTTACAGG + Intronic
937791523 2:125967675-125967697 GGGGTAGCTGTCTTTCATCAAGG - Intergenic
937971879 2:127556289-127556311 GTGTTAGGTGATTTTCTTGAAGG + Intronic
943891097 2:193288438-193288460 GTGTTAGGTGAGTTTCTTGAAGG + Intergenic
944631739 2:201633694-201633716 TGGTTCGCTGACTTTCTAGAAGG + Intronic
944980243 2:205109316-205109338 GTGTTAGCTGATTTTCTGGAAGG - Intronic
946780346 2:223188300-223188322 TGGTTACCTGACATTCCTAAGGG + Intronic
946959532 2:224969267-224969289 ACGTTAGATGACTTTCTTAAGGG - Intronic
947516166 2:230806878-230806900 GGGTTAGCAGGATTTCTTCAGGG + Intronic
1169708765 20:8537539-8537561 GGGTCACCTGACTTTCTTGGTGG + Intronic
1170920138 20:20670389-20670411 GGGTTAGGTGACTTGCCCAAGGG - Intronic
1171933806 20:31254446-31254468 AGGTTAACTGACTTTCTTAAGGG - Intergenic
1172382535 20:34507549-34507571 GGGTTATTTCACTTTCTTGATGG + Intronic
1182682827 22:32095748-32095770 GTGTTAGGTGAGTTTCTTGAAGG + Intronic
1182804532 22:33058673-33058695 AGGTCAGCTGACTTTCCCAAAGG - Intergenic
1183882879 22:40850366-40850388 GGGTTAGCATATTTGCTTAAAGG - Intronic
950328133 3:12132372-12132394 GAATTAACTGACTTGCTTAAAGG - Intronic
956923617 3:73957796-73957818 TTGTTTGCTGACTTTCTGAAGGG + Intergenic
957150737 3:76482883-76482905 GGGTTAGCTGGCTTTTATATGGG + Intronic
960301211 3:116005176-116005198 GAGTTAGCTCTCTTTCTTTAGGG - Intronic
962829731 3:139129442-139129464 AGGTTAAGTGACTTACTTAAAGG - Intronic
962916750 3:139911419-139911441 GGGTGAGATGACCTTGTTAATGG - Intergenic
964056064 3:152459636-152459658 GGGTTGGCAAACTTTCTTATAGG + Intronic
965260512 3:166478097-166478119 GGGTGAGCTCACTTTCCTGAAGG + Intergenic
967816705 3:193805395-193805417 GGTTTATATGACTTTCTAAAAGG + Intergenic
969059662 4:4424804-4424826 TGGTTAGCTGCCCTTCATAAGGG + Intronic
971390114 4:26177688-26177710 AAGGTAGCTGACTTTCTTAGTGG - Intronic
972481217 4:39498255-39498277 AGGTATGCAGACTTTCTTAAAGG + Intergenic
976527185 4:86107295-86107317 GGGTCTGCTGAGCTTCTTAATGG + Exonic
977219523 4:94322719-94322741 GGGTTCGCTGATTTTTTGAAGGG + Intronic
977456401 4:97266525-97266547 GGTTTAGCTGTATTTTTTAATGG - Intronic
980975009 4:139602463-139602485 GGCTTAAGTGACTTTCCTAAGGG + Intronic
984349196 4:178569536-178569558 AGGTTGGCTGACTGTCTTTATGG - Intergenic
986261204 5:6147953-6147975 GGATTAGCTGCCCTTCTAAAAGG - Intergenic
986868067 5:12013470-12013492 GGGTGACCTGACTTAATTAATGG - Intergenic
987192869 5:15497181-15497203 GTGTTAGCAGACTTCCTTACAGG + Intergenic
989406025 5:41061702-41061724 GGCTTTGCTGAATTTCTCAAGGG + Exonic
989481598 5:41936836-41936858 GGGTCAGGAAACTTTCTTAAAGG + Intronic
990256121 5:53971835-53971857 TGCTTTGCTGAATTTCTTAAAGG + Intronic
992214251 5:74509757-74509779 GTGTTTGCTGACATGCTTAAAGG - Intergenic
993743470 5:91566772-91566794 GTGTTAGATGAGTCTCTTAAAGG - Intergenic
997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG + Intronic
1000662879 5:163957696-163957718 GGGTCTGCTGGCTTTCTTCACGG + Intergenic
1004780222 6:18900198-18900220 GGGGAAACTCACTTTCTTAAAGG - Intergenic
1005109873 6:22268956-22268978 AGGTTAGATGACTTGCTCAAGGG - Intergenic
1008256328 6:49304586-49304608 GTGTTAGGTGAGTTTCTTGAAGG - Intergenic
1008366513 6:50686985-50687007 GGGAAAGCTGACCTTCTAAAAGG - Intergenic
1008370924 6:50729407-50729429 CTGTTAACTGACTTGCTTAATGG - Intronic
1008951204 6:57161520-57161542 GGGTTAGCAAACTTTTTAAAGGG - Intronic
1010164902 6:72904249-72904271 GTGTTAGATGAGTGTCTTAAAGG + Intronic
1010605762 6:77888368-77888390 TGGTTTCCTGACTTTCTTAATGG + Intronic
1014323044 6:119955894-119955916 AAGTTAGCTAACTTCCTTAATGG + Intergenic
1015471385 6:133610643-133610665 GGGTTACTTTTCTTTCTTAAAGG + Intergenic
1015867114 6:137738835-137738857 GGGTTAGGGCACTTGCTTAACGG + Intergenic
1017214749 6:151897578-151897600 GTGTTAGGTGAGTTTCTTGAAGG + Intronic
1017713687 6:157192158-157192180 GGGGTAGCTGTTTTTCTTAGTGG + Intronic
1028192172 7:87866344-87866366 GAGTTAGATGACATTTTTAAAGG - Intronic
1031015463 7:116570891-116570913 GGGTTGGGTGATTTTCTTCATGG - Intergenic
1031139066 7:117921124-117921146 GTGTTAGGTGAGTCTCTTAAAGG - Intergenic
1031407917 7:121407641-121407663 GGATTAGCTCTCTTTCTGAATGG - Intergenic
1031496218 7:122451381-122451403 GGCTTATCTGATTTTCTAAAAGG + Exonic
1035270564 7:157717444-157717466 GGGTCAGCTGACTTAGTCAAAGG + Intronic
1040563794 8:48547971-48547993 GAGTTAGCTCACTTTTTTGAGGG + Intergenic
1046929706 8:119829823-119829845 AGGTTAAGTAACTTTCTTAAGGG - Intronic
1047593914 8:126357051-126357073 GAGTTATGTGACTTTCCTAAGGG + Intergenic
1050806298 9:9682760-9682782 CTGGTAGCAGACTTTCTTAAAGG - Intronic
1051099186 9:13501605-13501627 GGGTTTGCTGTCGTTCTTACTGG - Intergenic
1055912005 9:81363971-81363993 GAGTCAGCTTGCTTTCTTAATGG + Intergenic
1056175527 9:84031267-84031289 GAGTTAGCTAACTTTCAGAAGGG + Intergenic
1059206485 9:112471872-112471894 GGATTAGCTAAATTGCTTAATGG - Exonic
1059525934 9:114991006-114991028 GGGTTGGATGACTTTGTAAAAGG - Intergenic
1059736119 9:117101541-117101563 TGTTTAGCTCACCTTCTTAATGG - Intronic
1061319975 9:129822912-129822934 GGCTTTGCTGGCTTTCTTATGGG - Intronic
1062692825 9:137853024-137853046 AGGTTACTTGAGTTTCTTAAAGG + Intronic
1062705552 9:137938502-137938524 GTGTTAGGTGAGTCTCTTAAAGG - Intronic
1186719418 X:12287252-12287274 TGGTTAGCTATCTCTCTTAAGGG - Intronic
1190436934 X:50434624-50434646 AGTTTAGCTGAATTTCTTGAAGG + Intronic
1191909340 X:66131212-66131234 GAGTTGGCTTACTTTCTCAATGG - Intergenic
1193791826 X:85823638-85823660 GTGTTAGCTGAGTCTCTTGAAGG - Intergenic
1195959626 X:110372073-110372095 GGAATAGCTAACTTTCTCAAAGG - Intronic
1195984978 X:110619936-110619958 GTGTTAGGTGACTCTCTTGAAGG + Intergenic
1196367185 X:114936442-114936464 GGGTTTACTGAGCTTCTTAATGG + Intergenic
1198896239 X:141458666-141458688 GCCTTAGCTTACTTTCTAAAAGG - Intergenic
1199082467 X:143592078-143592100 TGGTTGCCTGACTTTCTTGATGG + Intergenic