ID: 997351676

View in Genome Browser
Species Human (GRCh38)
Location 5:133235527-133235549
Sequence CTGGCTAATTAGCTGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997351669_997351676 14 Left 997351669 5:133235490-133235512 CCCCACCTCCAAAAAAAAAAAAA 0: 19
1: 327
2: 3682
3: 14092
4: 52435
Right 997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997351671_997351676 12 Left 997351671 5:133235492-133235514 CCACCTCCAAAAAAAAAAAAAAA 0: 151
1: 6129
2: 93409
3: 79405
4: 155026
Right 997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997351673_997351676 6 Left 997351673 5:133235498-133235520 CCAAAAAAAAAAAAAAAAAAAGA 0: 843
1: 15463
2: 19308
3: 33435
4: 76723
Right 997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997351670_997351676 13 Left 997351670 5:133235491-133235513 CCCACCTCCAAAAAAAAAAAAAA 0: 32
1: 620
2: 7436
3: 29427
4: 63104
Right 997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997351672_997351676 9 Left 997351672 5:133235495-133235517 CCTCCAAAAAAAAAAAAAAAAAA 0: 1109
1: 9573
2: 33196
3: 125625
4: 127619
Right 997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997351676 Original CRISPR CTGGCTAATTAGCTGGATGA AGG Intronic
900333183 1:2146915-2146937 ATGGCTGGTTGGCTGGATGAGGG - Intronic
902086637 1:13867897-13867919 TTGGTTAATTAGCTGGTTAAAGG - Intergenic
902243152 1:15101951-15101973 CTGGCTGGCTGGCTGGATGATGG - Intronic
906142265 1:43540764-43540786 CTGGCCAACTGGCTGGAGGAGGG + Intronic
906236979 1:44217953-44217975 ATGGCTAATTACCTGGAGAAAGG - Intronic
907226164 1:52948817-52948839 ATGGCTAATTAACTGGATTGTGG - Intronic
907248255 1:53121609-53121631 ATAGCTAATGTGCTGGATGAGGG + Intronic
909254114 1:73396680-73396702 TTGGCTGGCTAGCTGGATGATGG - Intergenic
914681893 1:149944387-149944409 CTGGCTTTTTGGCTGGAGGAGGG + Exonic
916858989 1:168782182-168782204 CTTGGTATTTAACTGGATGAGGG - Intergenic
918123928 1:181565798-181565820 ATGGATAATTAGCTGGATCCTGG + Intronic
920415997 1:205799747-205799769 CTGCCTTCTTACCTGGATGAGGG + Exonic
922417472 1:225434691-225434713 CTGGATAACTTGCTGGATAAGGG - Intergenic
922688310 1:227665289-227665311 ATGTGTAATTAGCTGGAAGATGG - Intronic
923425578 1:233865643-233865665 CTGGCTGATTAGCTGGAGTGGGG - Intergenic
924068781 1:240254562-240254584 CTGGCAGAATAGCTGGATGGGGG + Intronic
1065804505 10:29382402-29382424 CTGGCACATTAGCTGCATAAAGG - Intergenic
1066229319 10:33416838-33416860 GTGGCTAGTTGGATGGATGATGG + Intergenic
1070837974 10:79463054-79463076 TTGGGTCATTGGCTGGATGATGG + Intergenic
1072847292 10:98845809-98845831 CTGGGTAATTTGCAGGCTGAAGG + Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078348946 11:10576496-10576518 CTGGCAAGTGATCTGGATGATGG - Exonic
1079675736 11:23224159-23224181 CTTGGTAATTAACTGGATGCAGG - Intergenic
1081246931 11:40778649-40778671 CTGGCTAAATAGATTGATCAAGG + Intronic
1084678261 11:70649505-70649527 CTGGCAAATGAACTGGAGGAAGG - Intronic
1086403780 11:86482825-86482847 CTGGCTAACTAGCTGGGAGCGGG - Intronic
1087449766 11:98305160-98305182 TTGGCTAATTATTTGGCTGAGGG + Intergenic
1088474337 11:110219668-110219690 TTGCCTAATTAGCTGGAAGAAGG + Intronic
1091674547 12:2479565-2479587 ATGTCTGATTAGCTGAATGATGG - Intronic
1095341831 12:41098581-41098603 CAGGCTTAATACCTGGATGATGG + Intergenic
1105935235 13:25092403-25092425 CTGGCTTAATACCTGGGTGATGG - Intergenic
1107418539 13:40223695-40223717 CTGGCTAATGATCTGGAGGAGGG - Intergenic
1109611069 13:64765099-64765121 ATTGATAATTAGCTAGATGAGGG - Intergenic
1112051221 13:95644884-95644906 CTGGGAAATTAGCTTGCTGAGGG - Intergenic
1114659964 14:24337845-24337867 CTGGCCAGTTAGCTGGATCTAGG - Intronic
1115748575 14:36464087-36464109 AAGGCTAATTAGATGGATCATGG + Intergenic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1119553450 14:75534656-75534678 GTTGCCAATTAGCTTGATGAAGG - Intronic
1119979699 14:79065902-79065924 CAGGCTTAATATCTGGATGATGG - Intronic
1120475396 14:84980327-84980349 ATGACAAATTAGCTGGATGAAGG - Intergenic
1124407590 15:29405571-29405593 CTGGGTAATTAGCTGTTTGGGGG - Intronic
1131156033 15:90076166-90076188 CTGGCAAATCAGCTGCATGTTGG + Intronic
1138756771 16:59496064-59496086 CTAGCTACTTAGCTAGATCAGGG - Intergenic
1140989862 16:80200134-80200156 CTGGATATTAAGCTTGATGAAGG + Intergenic
1148528996 17:48371453-48371475 CTATCTAATTAGCTGACTGAGGG - Intronic
1151381742 17:73730451-73730473 CTGGCTAATACACTGCATGAAGG + Intergenic
1154378482 18:13828428-13828450 CTGGCAAATTAGCAGGCTGTTGG + Intergenic
1156668587 18:39439046-39439068 TTGGCTTAATAGCTGGGTGATGG + Intergenic
1159863183 18:73673268-73673290 CTGGATATTTAGCAGGATTATGG - Intergenic
1164482653 19:28625609-28625631 CTGGCTAAATAACTAAATGAAGG - Intergenic
1164694664 19:30234317-30234339 CTGGCTCTTCAGCTGGATGCTGG + Intronic
1165388035 19:35523211-35523233 CAGGCTGATTAGCTGTAAGAGGG - Intergenic
1166386122 19:42382380-42382402 CTGGCTTATCAGCTCCATGAGGG - Intergenic
1166956342 19:46468008-46468030 CTGGCTAGATAACTGGAGGATGG + Exonic
1168540694 19:57207232-57207254 CTGTCTACTTGGCTGGATGCAGG - Intronic
927630403 2:24768688-24768710 TTGGCTTCTTATCTGGATGAAGG + Exonic
928305669 2:30168452-30168474 GTGGATAATTAGATGGCTGATGG + Intergenic
932489366 2:72110262-72110284 CTGGAGAGTTAGTTGGATGATGG - Intergenic
938152041 2:128895413-128895435 CTGGCTAATTAGGTGAGTGCTGG + Intergenic
938365341 2:130729201-130729223 CTTGCTGATGAGCTGGATCAGGG - Exonic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
940673909 2:156705305-156705327 CTGCCTAATTAGCTGCATTAGGG + Intergenic
941081479 2:161065980-161066002 CTGGCTCATTTGCTGGCTGTCGG - Intergenic
941798649 2:169629823-169629845 CTGGCTAATGAAATGAATGAAGG - Intronic
1174110488 20:48194777-48194799 CGGGCGAATGAGCTGGACGAGGG + Intergenic
1174603807 20:51745757-51745779 CTGGCTACTGTGCTGGATGATGG - Intronic
1178424858 21:32471129-32471151 ATGGTTCCTTAGCTGGATGAGGG + Intronic
1181236082 22:21448379-21448401 CTGGCTAATTACCAAGATGAGGG - Exonic
950212153 3:11131696-11131718 CTGGATAATTCGCTGGGTGGAGG - Intergenic
951322031 3:21256649-21256671 TTGGCTTAGTAGCTGGTTGATGG + Intergenic
955021766 3:55128524-55128546 ATGGTTCATTAGCTGGAGGACGG - Intergenic
956088840 3:65642179-65642201 CTGGGTAATTATCTCGTTGATGG + Intronic
956554528 3:70503852-70503874 ATGGCTCAGTACCTGGATGACGG + Intergenic
957190172 3:76997920-76997942 CTGGCTAGTTTCCTAGATGATGG - Intronic
960659922 3:120046119-120046141 GTGGCTAAATAGGTGGATGTTGG + Intronic
960987398 3:123289943-123289965 CTCGCTGATGATCTGGATGAAGG + Exonic
961883072 3:130076698-130076720 CTGGCAAATGAGTTGGATGCTGG + Intergenic
966089775 3:176118946-176118968 CTAGCTCACTACCTGGATGAAGG + Intergenic
967673999 3:192273975-192273997 CTGTATAATTATCTGGCTGATGG - Intronic
970088055 4:12369603-12369625 CTCTTTAATTAGCTGGATGCAGG - Intergenic
974215265 4:58838269-58838291 CAGGTTCATTATCTGGATGATGG + Intergenic
977278552 4:95010097-95010119 CTGGCTAATTGGCTAAATGCTGG + Intronic
977929174 4:102732941-102732963 CTGGCTGATGATCTGGTTGACGG + Intronic
979309161 4:119182247-119182269 CTAGCAAATTGGCTGGATAAAGG + Intronic
982353738 4:154444447-154444469 TTGGCTGATGAACTGGATGAGGG - Intronic
985198380 4:187458447-187458469 TTGGGTAATTAGATGTATGATGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
988088291 5:26500771-26500793 CTTGTTAATTAGCTTGATTATGG - Intergenic
989530380 5:42501004-42501026 CTGGCTCATTATCTGGAAGCTGG + Intronic
990062267 5:51666748-51666770 CTGGTTACTTAGGAGGATGAGGG - Intergenic
990722259 5:58709873-58709895 CTCTCTAATTAGCTGTGTGATGG + Intronic
993423359 5:87730389-87730411 CTGACTGACTAGCTGAATGAAGG + Intergenic
994886503 5:105569417-105569439 CTTCCTAATTAGGAGGATGAGGG + Intergenic
996180634 5:120415183-120415205 CTGGCTAAAGAGCTGCATAAAGG - Intergenic
997351676 5:133235527-133235549 CTGGCTAATTAGCTGGATGAAGG + Intronic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1007817278 6:44533527-44533549 CTGGCTTTGTAGCTGGATGCAGG + Intergenic
1009616396 6:66013016-66013038 CTGGTTAAATAGCTGGCTTAGGG + Intergenic
1009939546 6:70274300-70274322 CAGGCTTAATAGCTGGGTGATGG - Intronic
1013974885 6:116065548-116065570 CTGGCAAATAAGTTGGAAGATGG - Intergenic
1015357776 6:132299325-132299347 CTGGCTCACTACCTGGGTGATGG + Intronic
1015851708 6:137580886-137580908 CTGGCTAAGTAGCTGGTTGCAGG - Intergenic
1017745781 6:157445880-157445902 CTGGATAATTTGCTGGGAGAAGG - Intronic
1018844993 6:167549435-167549457 CTGGCAAATTTGCTGCATAATGG - Intergenic
1022279934 7:28897613-28897635 CTGGCAGATTTGCTAGATGAAGG + Intergenic
1024723258 7:52162564-52162586 CTGGCTGATCAGCCGGAAGATGG - Intergenic
1026240177 7:68567035-68567057 CTGGCTTAATACCTGGGTGATGG + Intergenic
1030883232 7:114906640-114906662 CTGGCAAACTCACTGGATGAGGG + Intergenic
1033449799 7:141452386-141452408 CAAGCTAATTTGCTGGAGGAAGG - Intronic
1035177228 7:157060122-157060144 CTGGCTTCTTAGCTGGCTGGAGG - Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1041985556 8:63918391-63918413 CTGGCTTGTTAGCTCCATGAAGG + Intergenic
1042028946 8:64453571-64453593 GTTGCTAATTATCTGGATGAGGG - Intergenic
1048195660 8:132329924-132329946 CTGGGTAGTTAGCTGAATGGTGG + Intronic
1049385663 8:142341794-142341816 CTGGGTAATTAACGGGATGGTGG - Intronic
1051666706 9:19472887-19472909 GTGTCAAATTGGCTGGATGATGG + Intergenic
1052794817 9:32913716-32913738 CTTGCTGATTTGCTGCATGAAGG - Intergenic
1056947912 9:91015960-91015982 CAGGTTAATTAGCTTGATGTAGG - Intergenic
1057080785 9:92173019-92173041 CTGGCGAATGAGCTTGATGCAGG - Intergenic
1059981496 9:119777385-119777407 TTGACTAAGAAGCTGGATGAAGG - Intergenic
1187490740 X:19748822-19748844 CTGGGTAATTGGGTGGATGATGG - Intronic
1189140548 X:38600955-38600977 CTGGCTGATTCCTTGGATGATGG - Intronic
1190431575 X:50382779-50382801 CTAGCTTATTAGCTGTAAGAGGG + Intronic
1193326565 X:80184878-80184900 CTGGCTTAGTACCTGGGTGATGG - Intergenic
1196135808 X:112208629-112208651 CTGTCTCACTAGCTAGATGAGGG + Intergenic
1197864988 X:131008139-131008161 CTGGCTAATTAGATGAGTAACGG - Intergenic
1201674279 Y:16561775-16561797 CATGCTAATTAGCTTGATGCTGG + Intergenic
1202082704 Y:21100994-21101016 CTGGCTACTTAGGAGGGTGAGGG + Intergenic