ID: 997351778

View in Genome Browser
Species Human (GRCh38)
Location 5:133236210-133236232
Sequence CCTCATCACCACCTGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997351769_997351778 12 Left 997351769 5:133236175-133236197 CCTTGAAGCTGGCCTCAGGCTCT 0: 1
1: 0
2: 1
3: 31
4: 281
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255
997351772_997351778 0 Left 997351772 5:133236187-133236209 CCTCAGGCTCTGGCAGGCCCTGC 0: 2
1: 1
2: 5
3: 84
4: 661
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255
997351765_997351778 27 Left 997351765 5:133236160-133236182 CCTTCTCATGATGGCCCTTGAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255
997351763_997351778 29 Left 997351763 5:133236158-133236180 CCCCTTCTCATGATGGCCCTTGA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255
997351768_997351778 13 Left 997351768 5:133236174-133236196 CCCTTGAAGCTGGCCTCAGGCTC 0: 1
1: 0
2: 2
3: 20
4: 217
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255
997351764_997351778 28 Left 997351764 5:133236159-133236181 CCCTTCTCATGATGGCCCTTGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997351778 Original CRISPR CCTCATCACCACCTGTGTGG TGG Intronic
900488716 1:2935740-2935762 CCTCATCCCCACGTGGGTGGTGG + Intergenic
902599156 1:17529473-17529495 CATCCACAGCACCTGTGTGGAGG - Intergenic
902780269 1:18700445-18700467 CCTCACAACCACCAGTGAGGGGG - Intronic
903569070 1:24291100-24291122 TGTCATCACCACCTGTGGGGGGG - Intergenic
910653955 1:89600940-89600962 ACTAAACACCACCTGTGTGAAGG + Intergenic
913273677 1:117118205-117118227 CCTCATCACCAAGAGGGTGGTGG - Exonic
916731826 1:167573378-167573400 CCTCTTCAGCTCGTGTGTGGTGG + Intergenic
917534418 1:175864053-175864075 CCTGGTCACTACCTGTTTGGTGG + Intergenic
917757851 1:178120950-178120972 GCTCATCTCCTCCTGTGTGGTGG + Intronic
918174902 1:182035236-182035258 CCTCTTCATTTCCTGTGTGGTGG - Intergenic
918175539 1:182041090-182041112 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
918262634 1:182809595-182809617 CCTTCTCTCCACCTGTGTGTGGG - Intronic
919811944 1:201414348-201414370 CTTCACAACCACCTGTGAGGTGG - Intronic
920454208 1:206085918-206085940 CCTCATAACCACCTGGGGTGAGG + Intronic
920714423 1:208326342-208326364 TCTCATCAGCACCTGTTTTGGGG - Intergenic
921355244 1:214279873-214279895 CCTCAGCACCACTTGAGAGGTGG + Intergenic
923074993 1:230602162-230602184 CCTCTTCTCCACCTTTCTGGGGG + Intergenic
923559374 1:235027196-235027218 CCCCAGCACCACCAGTGGGGTGG - Intergenic
1063131912 10:3185570-3185592 CCACACAACCACCTGTGTGTGGG + Intergenic
1063306989 10:4911382-4911404 CCTCTTTAGCTCCTGTGTGGTGG + Intergenic
1063307458 10:4918335-4918357 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
1063444531 10:6102258-6102280 CCTCCCCACCACCTGTGGGAAGG + Intronic
1066102753 10:32132511-32132533 CCTCTTCAGTTCCTGTGTGGCGG - Intergenic
1067575778 10:47407425-47407447 CATCCTCACCTCCTGGGTGGGGG + Intergenic
1068417726 10:56745728-56745750 CCTTTTCAGCTCCTGTGTGGTGG + Intergenic
1068428387 10:56898284-56898306 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
1069099682 10:64304373-64304395 TCTCATCTCCACCTCTGGGGTGG - Intergenic
1069246898 10:66218018-66218040 CCTCTCCAGCTCCTGTGTGGTGG + Intronic
1072577028 10:96709792-96709814 CCTCAGCACCCGCTGTGTCGTGG - Exonic
1072803176 10:98407512-98407534 CATCTTCCCAACCTGTGTGGGGG - Intronic
1073186070 10:101615714-101615736 ACCCATCACCATCTTTGTGGGGG + Intronic
1076705705 10:132300382-132300404 CCACTTCTCCACCTGTGAGGAGG - Intronic
1076761382 10:132607628-132607650 CCTCCTCGCCACCCGTGTGGGGG + Intronic
1076777130 10:132704132-132704154 CCTCGACACCTCCTGTCTGGGGG - Intronic
1077896849 11:6459373-6459395 CCTCTTCACCCCCTCTGTGTGGG + Intronic
1079241019 11:18722028-18722050 CCTCACGACCTCCTCTGTGGGGG + Exonic
1081508956 11:43748507-43748529 TATCCTCACTACCTGTGTGGTGG + Intronic
1084190260 11:67495444-67495466 CCCCAGCACCACCAGTGAGGTGG - Exonic
1084793976 11:71491941-71491963 CCTCCCCACCTCCTGTGTGGTGG + Intronic
1084801441 11:71546904-71546926 CCTCCTTACGACCTGTGTGCTGG - Intronic
1084853206 11:71960819-71960841 CCTCATCGCAACCTTGGTGGTGG + Exonic
1085704047 11:78770143-78770165 CCTAATAACCACCTGTGAGTGGG + Intronic
1085731958 11:79007644-79007666 CCTCCTCCCCACCTGTCTAGGGG + Intronic
1087492772 11:98849049-98849071 CCTCTTCAGCTCATGTGTGGTGG + Intergenic
1090686914 11:129131732-129131754 CCACATCACCAGGTGAGTGGTGG + Intronic
1091787796 12:3253463-3253485 CCTCACCACAACCTATGAGGAGG - Intronic
1092013842 12:5140077-5140099 CCTCTTCAGCTCGTGTGTGGTGG - Intergenic
1092230275 12:6772358-6772380 CCACCTCTCCACCTCTGTGGTGG - Intergenic
1092335392 12:7628621-7628643 CGTCAAAACCACCTCTGTGGTGG - Intergenic
1093438347 12:19163814-19163836 CCTCCTAACCACCTCTGTAGAGG + Intronic
1094376424 12:29794704-29794726 CCTCAACACCATCAGTGAGGTGG - Intergenic
1094640848 12:32273900-32273922 CCTCTTCAGTTCCTGTGTGGTGG - Intronic
1096182584 12:49558845-49558867 CCTCAGCAACAACTCTGTGGTGG - Exonic
1097419595 12:59358068-59358090 CCTCTTCATCTCGTGTGTGGTGG + Intergenic
1098947832 12:76608198-76608220 CCTCTTCACCTCGTGTGTGCTGG - Intergenic
1099695387 12:86012820-86012842 CACCACCACCACCTGGGTGGTGG + Intronic
1100034532 12:90234802-90234824 CCTCTTCAGCTCCTGTGTGGTGG + Intergenic
1100233534 12:92634330-92634352 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
1103736020 12:123061332-123061354 CCTCATCAACAGCTCTGTGAGGG + Intronic
1103906159 12:124328187-124328209 CCCCACCTCCACCTGTGTGATGG + Intronic
1104197289 12:126553353-126553375 TGTCATCAACACCTGTGAGGGGG + Intergenic
1104220335 12:126776464-126776486 CCTCTTCAGCTCATGTGTGGTGG + Intergenic
1105750711 13:23420103-23420125 CCTCATGTCCACCTGTGGTGTGG + Intronic
1105833890 13:24192054-24192076 CCTCTTCAGCTCCTGTGTGGTGG - Intronic
1108582156 13:51836998-51837020 CCTCAGCACCTCCTCTGGGGAGG - Intergenic
1108632846 13:52303051-52303073 CCACAACCCCAGCTGTGTGGAGG - Intergenic
1108653852 13:52509546-52509568 CCACAACCCCAGCTGTGTGGAGG + Intergenic
1109289698 13:60458638-60458660 GATCATCACCAACTGTGTGATGG + Intronic
1112286132 13:98106056-98106078 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
1112445189 13:99457905-99457927 CCACCTCACCACCTCTGTGAAGG - Intergenic
1112672732 13:101659746-101659768 CCTCACCAGGACCTGTGCGGTGG - Intronic
1113972878 13:114203691-114203713 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
1116256409 14:42562193-42562215 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
1117938561 14:60936042-60936064 CCTCCTCAGTTCCTGTGTGGTGG - Intronic
1119917879 14:78419068-78419090 CCTCAGCACCATCTTTGGGGTGG + Intronic
1122389378 14:101369867-101369889 CCTCACCACCGCCTGGGAGGTGG - Intergenic
1122878243 14:104678602-104678624 CCTCCTCACTCCCTTTGTGGTGG + Intergenic
1124886661 15:33693653-33693675 CCTCACCACCAGATGTGTGTGGG - Intronic
1125061859 15:35435542-35435564 CCTCTTCAGCTCATGTGTGGTGG + Intronic
1126683733 15:51228650-51228672 ACTCATCACATCCTGTGTCGTGG - Intronic
1128075909 15:64825416-64825438 CCTCGTCCCCACCTTGGTGGTGG - Intronic
1128101785 15:65007126-65007148 CCTCTTCAGCTCCTGTGTGGTGG + Intronic
1129253438 15:74320832-74320854 CCTCATCACCACCAGAGGGCAGG - Intronic
1129451009 15:75651427-75651449 TCTCATGACCCCCTCTGTGGGGG + Intronic
1130356223 15:83133075-83133097 CCTCATAACAACCTATGAGGTGG + Exonic
1132118670 15:99158071-99158093 CCTCATCAGCACCTGTAATGTGG - Intronic
1132551347 16:555061-555083 GCTCAGCAGCACCCGTGTGGGGG - Intergenic
1132561244 16:595259-595281 CCCCACCACCACCTGTGAGAAGG + Intronic
1133730568 16:8575074-8575096 CATCATCACCAATTTTGTGGGGG + Intronic
1134648046 16:15886594-15886616 TCTCATCAGCACCTCAGTGGTGG + Intronic
1135741434 16:24978639-24978661 CCTCCTAACAACCTGTGAGGTGG + Intronic
1135854369 16:25993235-25993257 CCTCATCCCCAGCTCTGGGGTGG - Intronic
1136081048 16:27852849-27852871 CCTCATCCTCACCTGCGGGGAGG - Intronic
1136122350 16:28146809-28146831 CCACATCAGCACCTGGTTGGAGG - Intronic
1136576485 16:31128200-31128222 CCTCATCACCACCAAAGGGGAGG + Intronic
1138521566 16:57574372-57574394 CCTCATCACCATCTCTGCAGTGG - Intronic
1139383481 16:66549425-66549447 CCTCAGAACCACCTGTGGGACGG - Intronic
1139479864 16:67224528-67224550 CCTCACCACCCCCTAGGTGGGGG - Intronic
1139633175 16:68243015-68243037 CCTTATGACCACCTGAGTTGTGG + Intergenic
1141088348 16:81112547-81112569 CATCATCACCACCTACCTGGGGG - Intergenic
1141720301 16:85751839-85751861 CGTCAGCCCTACCTGTGTGGAGG + Intergenic
1141736507 16:85857700-85857722 CCTGATCACCCCCTCTGTGGGGG + Intergenic
1142210955 16:88808248-88808270 CCTCCTCAGCACGTGTCTGGTGG - Exonic
1142673065 17:1496391-1496413 CCGCAGCCCCACCTGTGAGGGGG + Exonic
1143533714 17:7523027-7523049 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
1143877141 17:10000470-10000492 CATCATTACCACCCGTTTGGAGG - Intronic
1144417772 17:15068278-15068300 CCTAATCACCTCCTTTTTGGGGG + Intergenic
1144504893 17:15821547-15821569 GCTCATAACCACCTGTGAGATGG + Intergenic
1144636192 17:16910774-16910796 GCTCATAACCACCTGTGAGATGG + Intergenic
1144645874 17:16973049-16973071 GCTCATAACCGCCTGTGAGGCGG - Intergenic
1145169066 17:20639430-20639452 GCTCATAACCACCTGTGAGATGG + Intergenic
1145789044 17:27613471-27613493 CCTCTTCAGCTCGTGTGTGGTGG - Intronic
1146006953 17:29166431-29166453 CCTCACCTCCACCTGTGGCGAGG + Exonic
1149034062 17:52115140-52115162 CCTCTTCAGCTCCTGTGTGGTGG + Intronic
1149762217 17:59242797-59242819 CCTCTTCAGCTCATGTGTGGTGG - Intronic
1152585475 17:81187699-81187721 CCTCACCAAAGCCTGTGTGGGGG - Intergenic
1203171830 17_GL000205v2_random:155457-155479 CCTCATCTCAGCCTATGTGGTGG + Intergenic
1203173903 17_GL000205v2_random:177300-177322 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1153089223 18:1324697-1324719 CCGCATTAACAACTGTGTGGTGG + Intergenic
1153704184 18:7728423-7728445 CCTCTTCAGCTCCTGTATGGTGG - Intronic
1155051103 18:22148634-22148656 CCTGATGGCCACCTGTTTGGAGG + Intergenic
1155922297 18:31615455-31615477 TATCGTCACCACCTCTGTGGAGG - Intergenic
1157116105 18:44864131-44864153 CCTCCTCCCCTCCTGTGTGAAGG + Intronic
1157172790 18:45423395-45423417 GCTCAGGACCCCCTGTGTGGAGG + Intronic
1157325985 18:46669136-46669158 CCTGCCCAGCACCTGTGTGGAGG - Intronic
1157777829 18:50410130-50410152 CCTCTTCAGATCCTGTGTGGTGG - Intergenic
1158423960 18:57322505-57322527 ACTCCTCACCACCAGTGAGGTGG - Intergenic
1163024940 19:14505506-14505528 CCCCATCACCTCCTGCCTGGTGG + Intergenic
1164702911 19:30298360-30298382 CCCCATCACCAGCTGTGCAGAGG + Intronic
1164763387 19:30744818-30744840 CCTCAGGACCACCTGCGTGAAGG - Intergenic
1165163398 19:33832105-33832127 CCTCCTCACCCCCTTGGTGGGGG - Intergenic
1167271469 19:48508916-48508938 CTTCACCACCACCTGGGCGGGGG + Exonic
1167313724 19:48752261-48752283 TCCCATCACCACCTCTGTGGTGG - Intronic
1167699546 19:51034468-51034490 CCTCCTCACCACCAGGCTGGGGG + Intronic
1168265908 19:55224046-55224068 CCTCTACACCACCTCTGTGTGGG - Intergenic
1168520491 19:57046504-57046526 CCTCCTCTCCACCTGTGAGCTGG - Intergenic
1168719926 19:58549312-58549334 CCTCATCACCACCTTGCAGGAGG + Exonic
926239166 2:11071502-11071524 CCTCTTCAGTTCCTGTGTGGTGG + Intergenic
926242571 2:11099914-11099936 CTTCCTCACCACCTGCCTGGCGG + Intergenic
926646542 2:15295905-15295927 CCTCATAACAAACTGTGAGGAGG - Intronic
928833472 2:35517242-35517264 CCTCTTCAGCTCTTGTGTGGTGG - Intergenic
930630746 2:53752427-53752449 CCTCTTCAGCTCATGTGTGGTGG - Intronic
931172740 2:59821892-59821914 CATCATTACCAGCTGTGGGGAGG + Intergenic
932840570 2:75078370-75078392 CCTCACAACCTCCTGTGAGGAGG - Intronic
933281923 2:80341235-80341257 CCTCATCCCCACCTCTGGGGAGG - Intronic
934743334 2:96741694-96741716 GCTCACCATCACCTGTGGGGAGG + Intergenic
935681100 2:105637891-105637913 CCCCGTCACCATGTGTGTGGGGG - Intergenic
935693829 2:105753562-105753584 CTTCATCAGTAGCTGTGTGGTGG + Intronic
935962990 2:108445502-108445524 CCTCTTCAACTCATGTGTGGTGG + Intergenic
936087123 2:109476943-109476965 CCTCATCACCACCTTGGTTTTGG + Intronic
937264825 2:120608851-120608873 GCTCATCCCCACCTGAGTGTTGG - Intergenic
937906129 2:127053748-127053770 CCTCATCACCTCCTGGTTGTAGG - Intronic
937987380 2:127644132-127644154 TCTCATCATCAGCTGTGTGCAGG + Intronic
938248775 2:129798028-129798050 CCTGATCCACACGTGTGTGGGGG + Intergenic
943149803 2:184097775-184097797 CCTCTTCAGCTCCTGTGTGGTGG + Intergenic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
943947323 2:194084587-194084609 CCTCTTCAACTCATGTGTGGTGG - Intergenic
946154672 2:217799638-217799660 CCTCCCCACCATCTGCGTGGTGG - Intergenic
946542534 2:220700738-220700760 CCTGATCACTACCTGGGTGACGG - Intergenic
946752096 2:222902746-222902768 ACTCTTCAGCTCCTGTGTGGTGG - Intronic
948296846 2:236867010-236867032 GCTCTTCACCACCTCTGTGGAGG + Intergenic
948969572 2:241414632-241414654 CCTCACCACTCCCAGTGTGGGGG + Intronic
1168880861 20:1204893-1204915 CCTCATCACCACCTCCGTGCTGG + Intronic
1172840650 20:37901332-37901354 CCTAAACACCACCTCTGTGTGGG + Intergenic
1174358915 20:50015828-50015850 CTTCATCACCGCCTGCGGGGAGG - Intergenic
1175240882 20:57547718-57547740 CCTCATCACCACCTGGCAAGGGG - Intergenic
1176060168 20:63169052-63169074 CCTCACCCACACCTGCGTGGCGG + Intergenic
1176329895 21:5538946-5538968 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1176397862 21:6282005-6282027 CCTCATCTCAGCCTATGTGGTGG + Intergenic
1176439295 21:6707099-6707121 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1176463557 21:7034168-7034190 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1176487118 21:7415947-7415969 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1177414808 21:20780050-20780072 CCTCTTCTGCTCCTGTGTGGTGG - Intergenic
1178062939 21:28872287-28872309 CCTCTTCAGCTCGTGTGTGGTGG - Exonic
1178149350 21:29776178-29776200 CCTCATAATCCCATGTGTGGAGG - Intronic
1179587764 21:42384507-42384529 CCTGGTCTCCACCTGTGTGTGGG - Intronic
1179810531 21:43866310-43866332 GCTCATCACCCTCTGTCTGGAGG - Intronic
1180153132 21:45962667-45962689 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
1180600674 22:17013121-17013143 CCTGCTCAGCACCTGTGGGGAGG + Intergenic
1181427105 22:22850814-22850836 CCTCTTCACAACCTGCCTGGAGG - Intronic
1181918273 22:26298427-26298449 CCCCACCACCACCTGTAAGGTGG + Intronic
1182254900 22:29031075-29031097 CCTCTTTACCTCCTGTGTGTTGG + Intronic
1183350480 22:37332005-37332027 CGGCAGCACCAGCTGTGTGGTGG - Intergenic
1183625206 22:38997533-38997555 CTGCATCAGCAGCTGTGTGGAGG - Intergenic
1183759121 22:39799583-39799605 CCTCTTCAGCTCGTGTGTGGTGG - Intronic
1184978036 22:48076950-48076972 ACTCCCCACCACCTGAGTGGTGG - Intergenic
1185134585 22:49062465-49062487 CCCCGTCACCATCTGTGTTGCGG - Intergenic
1185367987 22:50445733-50445755 TCCCAACACCACCTGTGGGGTGG + Exonic
950654211 3:14426758-14426780 CCTCATCCCTACCTGGGAGGAGG + Intronic
950889193 3:16387905-16387927 CCTCACCACCACCTTTCTGCTGG + Intronic
952454332 3:33458492-33458514 CCTCTTCAGCTCATGTGTGGTGG - Intergenic
953392348 3:42540859-42540881 CCTCCTCCCCACCTGGATGGGGG - Intergenic
953964827 3:47296060-47296082 CGTCAGCATCACCTGGGTGGGGG + Intronic
956512834 3:70013318-70013340 CCTCATAACAACCTTTGAGGAGG - Intergenic
956660509 3:71592582-71592604 CCTCAGCATCACCTGGATGGAGG + Intergenic
958536198 3:95407854-95407876 CCTCATCAGCTCCTGTGTGGTGG + Intergenic
960750503 3:120946602-120946624 CCTCAAAACCACCTGTGATGGGG - Intronic
962582591 3:136811832-136811854 CCTCTTCAGCTCATGTGTGGTGG - Intergenic
962852843 3:139320568-139320590 CCTCACTGCCACCTGTGAGGTGG - Intronic
963171379 3:142254746-142254768 CCTCTTCAGCTCTTGTGTGGTGG + Intergenic
964955721 3:162353579-162353601 CTTCATGACCACCTGTCTGTGGG - Intergenic
965364122 3:167777511-167777533 CCACAACATCACCTGTGTAGTGG - Intronic
966028715 3:175319080-175319102 CCTCACCCCCACCCATGTGGGGG - Intronic
966466520 3:180235722-180235744 CCTCTTAAGCTCCTGTGTGGTGG + Intergenic
967574258 3:191071850-191071872 CTGCATCACCATCTGTTTGGCGG - Intergenic
968493500 4:903130-903152 GCCCAGAACCACCTGTGTGGCGG + Intronic
968669512 4:1841491-1841513 CTTCACCACCACCTCTGCGGGGG + Exonic
969091695 4:4698743-4698765 TCCCAGCTCCACCTGTGTGGAGG - Intergenic
969584243 4:8082897-8082919 CCTCATCACCTGCTAAGTGGGGG - Intronic
969593637 4:8135846-8135868 GCTCTTCACCACCTGTGAAGTGG - Intronic
971572420 4:28230262-28230284 CCTCTTCAACTCCTATGTGGTGG + Intergenic
976862438 4:89681472-89681494 CCTCTTCAGCTCCTGTGTGGTGG + Intergenic
977971603 4:103219123-103219145 CCTCATCACAACCACTGTGAAGG + Intergenic
979968080 4:127100201-127100223 CAACATCACCACATGTGTGTTGG + Intergenic
980823416 4:138045106-138045128 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
981770765 4:148304830-148304852 CCTCTTCAGCTCCTGTGTGGTGG + Intronic
983450011 4:167897217-167897239 CCTCATCAACTCCTGTGTGGTGG - Intergenic
983705112 4:170648282-170648304 CCTCATCATCTCATGTGTGGTGG - Intergenic
983852949 4:172605919-172605941 CCTCTTCAGCTCCTGTATGGTGG - Intronic
985819550 5:2150276-2150298 CCTCACCACTACCCCTGTGGGGG + Intergenic
988069853 5:26273882-26273904 CCTCTTCAGCTCATGTGTGGTGG + Intergenic
989691614 5:44151833-44151855 CCTCTTCAGTTCCTGTGTGGTGG + Intergenic
989715591 5:44458637-44458659 CCTCTTCAGTTCCTGTGTGGTGG - Intergenic
990444888 5:55885472-55885494 CCTCTTTAGCTCCTGTGTGGTGG - Intronic
992859199 5:80894296-80894318 CCTCTTCAGCCCCTGTGTGGTGG + Intergenic
993236738 5:85320615-85320637 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
995708461 5:115010502-115010524 CATCATCTCCCTCTGTGTGGTGG - Intergenic
996955410 5:129177550-129177572 CCTCTTCAGCTCATGTGTGGTGG - Intergenic
997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG + Intronic
997738455 5:136232372-136232394 CCTCATGACCAGCTCTGTGGCGG + Intronic
1001633915 5:173196398-173196420 CCTCCTTTCCAGCTGTGTGGTGG + Intergenic
1003061067 6:2862975-2862997 CCTTCTCACCACCTGTTTTGGGG - Intergenic
1005445514 6:25918535-25918557 CTTCATCATCCTCTGTGTGGGGG - Exonic
1006841279 6:37029387-37029409 CCTCATCCCCACCTCGCTGGTGG + Intergenic
1007729790 6:43938908-43938930 CCACTTCCCCTCCTGTGTGGGGG + Intergenic
1010846959 6:80720704-80720726 CCTCATCACCTGCAATGTGGTGG - Intergenic
1011882395 6:92045841-92045863 CCTCTTCAGCTCCTGTGTGGCGG + Intergenic
1012742786 6:103041065-103041087 CCTCTTCAGCTCCTGTGTAGTGG - Intergenic
1013034014 6:106362446-106362468 CCTGATCCCCTCCTGTGTGCTGG - Intergenic
1014774558 6:125493833-125493855 ACCCATCACCACCTGTTTGAGGG - Intergenic
1016690708 6:146934549-146934571 ACCCATGACCAGCTGTGTGGGGG + Intergenic
1017560000 6:155616305-155616327 CCTCTTCAGCTCATGTGTGGTGG - Intergenic
1017905431 6:158754833-158754855 TCTCATCTCCAGCTGTGTGTGGG - Intronic
1019965843 7:4497588-4497610 CCTCATCGCCAGCTGTGTACTGG - Intergenic
1020955827 7:14739415-14739437 CCTCTTCAGCTCATGTGTGGTGG + Intronic
1020956515 7:14745674-14745696 CCTCTTCAGCTCATGTGTGGTGG + Intronic
1021139998 7:17012563-17012585 AAGCATCACCACTTGTGTGGAGG + Intergenic
1021603431 7:22387315-22387337 CCTCATCACTGACTGTGTGATGG + Intergenic
1023437833 7:40156606-40156628 CCCCTTCACCACCTCTGAGGTGG + Intronic
1023972634 7:45002691-45002713 CATCATCACCACATGTGCTGAGG - Intronic
1024005236 7:45220280-45220302 CCTCATCACCAACTGAGTGGGGG + Intergenic
1027218013 7:76196655-76196677 CCTCATCTGCACCTGTGTGCAGG - Intergenic
1029666513 7:101998540-101998562 CAGCATCACGACCTGTTTGGGGG + Intronic
1030496643 7:110308949-110308971 CCTCTTCAGCTCATGTGTGGTGG - Intergenic
1031993367 7:128212015-128212037 CCACATCAGCATCTGTGTTGAGG + Intergenic
1032255222 7:130291769-130291791 CCTCATCCCCACCTTTGATGGGG + Intergenic
1035906803 8:3520780-3520802 CCCCATCACCACATCTGTAGAGG + Intronic
1036121431 8:6021533-6021555 CCCCATCACCCCATGTGTTGAGG - Intergenic
1036605711 8:10303698-10303720 CCTCTTCCTCACCTGTGGGGAGG - Intronic
1038495654 8:28000203-28000225 CCTCATAACCACCCTTGAGGTGG - Intergenic
1039553734 8:38461729-38461751 CCTCATAATCACCTGTGATGTGG - Intronic
1040063129 8:43121664-43121686 CCTCCCCACCCACTGTGTGGTGG + Intronic
1040488083 8:47893307-47893329 TCTCATCAACACCTTTGAGGGGG - Exonic
1041254869 8:55971434-55971456 CCAAATCACCACCTGAGTAGAGG - Intronic
1042496746 8:69463447-69463469 CCTCCCCACCAAGTGTGTGGAGG + Intergenic
1042864979 8:73349190-73349212 CCTCATGACAACCTGTGAGCTGG + Intergenic
1043680972 8:83023911-83023933 CCTCTTCAACGCATGTGTGGTGG - Intergenic
1044740738 8:95323658-95323680 CCTCTTCAGCTCGTGTGTGGTGG - Intergenic
1046508890 8:115173079-115173101 CCTCTTCAGCTCGTGTGTGGTGG + Intergenic
1046648469 8:116811033-116811055 CTACATCAACACCTGTGGGGTGG - Intronic
1052059878 9:23946656-23946678 CCTCTTCAGCTCCTGTGTGGTGG - Intergenic
1052082414 9:24223504-24223526 CCTGTTCTTCACCTGTGTGGTGG + Intergenic
1053562591 9:39211202-39211224 CCTCATCACCACCTGGGATGGGG + Intronic
1053828397 9:42049194-42049216 CCTCATCACCACCTGGGATGGGG + Intronic
1054134559 9:61407837-61407859 CCTCATCACCACCTGGGATGGGG - Intergenic
1054602162 9:67138260-67138282 CCTCATCACCACCTGGGATGGGG - Intergenic
1055118696 9:72633756-72633778 TCTAATCACCAAATGTGTGGAGG + Intronic
1055202522 9:73684307-73684329 CCCCTTCAGCTCCTGTGTGGTGG - Intergenic
1057787731 9:98099772-98099794 TCTCTTGACCACCTGTGTGGGGG + Intronic
1057975045 9:99596466-99596488 CCTCATCAAGCCCTATGTGGAGG + Intergenic
1061138720 9:128751581-128751603 CCTCACCACCCCCAGTGGGGAGG - Intronic
1203432200 Un_GL000195v1:101380-101402 CCTCATCTCAGCCTATGTGGTGG + Intergenic
1203434295 Un_GL000195v1:123164-123186 CCTCATCTCAGCCTATGTGGTGG - Intergenic
1186460906 X:9748062-9748084 CCACATCTCCCTCTGTGTGGAGG + Intronic
1189064601 X:37793981-37794003 ACTCCTCACCTCATGTGTGGAGG + Intronic
1189415588 X:40809919-40809941 CCTCTTCAGTTCCTGTGTGGTGG + Intergenic
1191189995 X:57656332-57656354 CCTCTTCAGCTCATGTGTGGTGG + Intergenic
1193699952 X:84748077-84748099 CCTCTTCAGTTCCTGTGTGGTGG + Intergenic
1195727544 X:107933996-107934018 CCTCATCAGAACCTGGGAGGTGG + Intergenic
1198043610 X:132878254-132878276 CCTCATCAGTTCTTGTGTGGTGG - Intronic
1198279510 X:135127819-135127841 CCTCATCCCCTTCTGGGTGGTGG - Intergenic
1198291447 X:135244695-135244717 CCTCATCCCCTTCTGGGTGGTGG + Intergenic
1200019470 X:153189634-153189656 GCTCATCTCCTCCTGTGTGCTGG - Intergenic