ID: 997353557

View in Genome Browser
Species Human (GRCh38)
Location 5:133247985-133248007
Sequence CCTTCCAACTCTGAGACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997353557_997353561 -5 Left 997353557 5:133247985-133248007 CCACAAGTCTCAGAGTTGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 229
Right 997353561 5:133248003-133248025 GAAGGGACCTCCAAGGTCACTGG 0: 1
1: 0
2: 0
3: 29
4: 185
997353557_997353562 -4 Left 997353557 5:133247985-133248007 CCACAAGTCTCAGAGTTGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 229
Right 997353562 5:133248004-133248026 AAGGGACCTCCAAGGTCACTGGG 0: 1
1: 0
2: 2
3: 27
4: 149
997353557_997353565 15 Left 997353557 5:133247985-133248007 CCACAAGTCTCAGAGTTGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 229
Right 997353565 5:133248023-133248045 TGGGTTTAGCTGCCCTCTTGTGG 0: 1
1: 0
2: 2
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997353557 Original CRISPR CCTTCCAACTCTGAGACTTG TGG (reversed) Intronic
900459874 1:2797910-2797932 ACTTCTAACTCTCAGACATGTGG + Intronic
903130266 1:21274551-21274573 ACTTCAGACCCTGAGACTTGAGG - Intronic
903243780 1:22001312-22001334 CCTTCAAGCTCTGCGACTTTGGG - Intergenic
903377580 1:22876437-22876459 CCTTCCTTGGCTGAGACTTGGGG - Intronic
903378739 1:22882648-22882670 CCTTCCCACTGTGAGACCTCAGG + Intronic
903499058 1:23791818-23791840 CCTTCCATCTCTGACCCCTGAGG - Intronic
904117397 1:28172809-28172831 CATTCCAGCTCTGAGCCTTGGGG + Intronic
904500733 1:30911435-30911457 CCTGCCAGCTCTGAGACTTCTGG + Intergenic
904903639 1:33877514-33877536 CATTACAACTCTGAGAATTTGGG + Intronic
906526548 1:46496579-46496601 CCTTCCAACTCTGAGCTTTTGGG - Intergenic
907138130 1:52158464-52158486 CCTTTGAACTCTGAGTCTTCAGG - Intronic
907689300 1:56645840-56645862 CCTTCCAGCTCTGAGCCTGTAGG + Intronic
907818821 1:57946825-57946847 CATTCCAACTGAGAAACTTGAGG - Intronic
912625200 1:111200452-111200474 CCTTCCATCTCTGGGCCTTCAGG + Exonic
912859136 1:113197516-113197538 CTTACCAGCTCTGTGACTTGGGG + Intergenic
913282923 1:117202720-117202742 CTTTCTAACTGTGAGACTTTGGG - Intronic
913382789 1:118229115-118229137 CCTTCCAATGCTCAGACTTCAGG - Intergenic
913574242 1:120154283-120154305 CTTTCTAACTCTGTGACTTTGGG + Exonic
914295513 1:146319086-146319108 CTTTCTAACTCTGTGACTTTGGG + Intergenic
914556552 1:148769867-148769889 CTTTCTAACTCTGTGACTTTGGG + Intergenic
914616282 1:149360363-149360385 CTTTCTAACTCTGTGACTTTGGG - Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
919769828 1:201150646-201150668 ATTTCCAACTCTGAGACTGTCGG - Intronic
920286058 1:204880721-204880743 CCTTCCAGCTGTGGGATTTGGGG + Intronic
923603738 1:235425026-235425048 GCTCCCAAGTCTGAGCCTTGGGG - Intronic
923869101 1:237971694-237971716 GCTGCCAACACTGAGACTTATGG - Intergenic
923969971 1:239189408-239189430 CCTCCAAATTCTGAGATTTGAGG + Intergenic
1068788505 10:61001863-61001885 CCACCCACCTCTGGGACTTGCGG + Intergenic
1069917678 10:71797465-71797487 CCTTCCTACTCTCAGCCTGGGGG - Intronic
1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG + Intergenic
1070604943 10:77892045-77892067 CCTCCCGAGTCTGGGACTTGTGG - Intronic
1071872261 10:89808533-89808555 TCCTCCAACTCTGAAACTTAGGG - Intergenic
1072669853 10:97421413-97421435 TCTCCCAGCTCTGACACTTGGGG + Intronic
1075260692 10:120961815-120961837 CCTTCCAAATCTGAGGAATGAGG - Intergenic
1076277775 10:129218917-129218939 CTTTTCAACTCTGAGATTTGGGG + Intergenic
1076896669 10:133316612-133316634 CTTTCCATCTCTGTGTCTTGGGG - Intronic
1076896721 10:133316798-133316820 CTTTCCATCTCTGTGTCTTGCGG - Intronic
1077848076 11:6046666-6046688 GCTGCCAACTCTGAAAGTTGGGG + Intergenic
1078140905 11:8692390-8692412 ACTTCCCACTCTGAGTCTTCTGG + Intronic
1078748958 11:14142030-14142052 CCTGCCAACTATGTGACTTTGGG + Intronic
1079907403 11:26266269-26266291 CCTTTAAAATCTGAGTCTTGGGG - Intergenic
1080694261 11:34587459-34587481 CCTTCCAGCTCTGTGACCTGGGG - Intergenic
1081440347 11:43073977-43073999 CTTTCCTACTTTGAGATTTGGGG - Intergenic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1083772566 11:64876694-64876716 CCTTCCAGCTCTGAAACTCTAGG + Intronic
1084287642 11:68142354-68142376 CCTCCCAACTGTGTGATTTGGGG - Intergenic
1084793651 11:71490458-71490480 CCTGTCAACTCTGAGGCCTGTGG - Intronic
1085044217 11:73343883-73343905 CCCGCCAGCTCAGAGACTTGAGG - Intronic
1085464584 11:76715225-76715247 CTTTCCAACTCTGTGACCTGGGG + Intergenic
1088879684 11:113963670-113963692 CCTTCCAGCTCCAACACTTGGGG + Intergenic
1089060050 11:115618959-115618981 CCTCAGAACTCTGAGCCTTGGGG - Intergenic
1089164975 11:116468851-116468873 CCTTCCAACTCTAATAGGTGAGG - Intergenic
1089439580 11:118504035-118504057 CCATCCAACTGTGAGATTTTTGG - Exonic
1089760259 11:120717795-120717817 CCTTCCAGCTCTGGGCTTTGTGG + Intronic
1089883862 11:121800800-121800822 CATTTCAACTCTGCGACTTTGGG + Intergenic
1090397637 11:126429677-126429699 CTTTCCAACACTGAGATTTATGG - Intronic
1091264500 11:134260091-134260113 CCTTCCATTACTGAGACTTGTGG - Intronic
1093345431 12:18034848-18034870 CCTTCCAATTCCCAGACTTCAGG - Intergenic
1098111215 12:67123755-67123777 CCTTTCAACTCTGAGATTCTAGG + Intergenic
1098150036 12:67537386-67537408 CCTCCTAACTCTGTGACTCGTGG + Intergenic
1100134732 12:91541637-91541659 CCTTCCAAATCTGATTCTAGAGG - Intergenic
1102490510 12:113287406-113287428 CCTTCCAACCCTCAGACCTGTGG - Intronic
1103159188 12:118713424-118713446 ACTTCCAACTGTGTGACTTTGGG - Intergenic
1112375411 13:98835660-98835682 CCTTCCCATTCTGAGACTGGAGG + Intronic
1112750761 13:102581210-102581232 CCTGTCAGCTCTGTGACTTGGGG - Intergenic
1114557174 14:23568670-23568692 CATCCCAACTCTGGGAGTTGTGG - Exonic
1114760288 14:25306739-25306761 CCTTCCAATTATGAGACTGGTGG + Intergenic
1115049269 14:29036618-29036640 CATTCCCACTCTGAAACTTTGGG + Intergenic
1118109303 14:62698028-62698050 CCTTCCAACCTTCAAACTTGTGG - Intergenic
1119690417 14:76667347-76667369 CTTGCTAACTGTGAGACTTGGGG + Intergenic
1124467446 15:29950839-29950861 ACTTCCTACTATGAGACTGGTGG - Intronic
1127272554 15:57414342-57414364 TCTTCCAAATCTGAGAGTCGAGG + Intronic
1128249789 15:66156124-66156146 CCTTCCAACCTGGAGACTTTGGG - Intronic
1128811589 15:70577008-70577030 CCTTCCAACTCTGAGACTCGAGG - Intergenic
1130031215 15:80316135-80316157 CCTTCCAGCTCTGACATTTAGGG - Intergenic
1131863110 15:96675739-96675761 CCTTCAAAGCCTGAGAGTTGTGG + Intergenic
1134045646 16:11098944-11098966 CCTTCCAGCAGTGAGACCTGTGG + Intronic
1135946540 16:26870017-26870039 CCTTCCAACCCTAAGGCTTAAGG - Intergenic
1137478946 16:48835138-48835160 TCTTCCATCTCTGAGATTTGAGG - Intergenic
1138131306 16:54482389-54482411 CCTTCCAATTCTGTCTCTTGAGG - Intergenic
1138325944 16:56168105-56168127 CATTCTAACTTGGAGACTTGAGG + Intergenic
1138389865 16:56662598-56662620 CCTTCCATTTCTGAGGCTAGAGG - Intronic
1138768723 16:59635931-59635953 TCTGCCATTTCTGAGACTTGTGG + Intergenic
1141621017 16:85236418-85236440 GCTAAAAACTCTGAGACTTGGGG + Intergenic
1142877394 17:2860137-2860159 CCTTCCAGCTCTGGGACTCTGGG - Intronic
1144572160 17:16407149-16407171 CAGTCCAGCTCTGTGACTTGGGG + Intergenic
1146792473 17:35760106-35760128 CCATCCAAGTCTGAGAGTGGAGG - Intronic
1147163753 17:38582450-38582472 ACTGCCAACTGTGAGATTTGTGG - Intronic
1147914815 17:43879948-43879970 CCTTCCCGCTCTGAGTCTTTCGG + Exonic
1148359379 17:46999218-46999240 CCTACCAGCTCTGTGACTTTGGG + Intronic
1149419721 17:56497740-56497762 CCTTCCAGCTCTGAAACTTTAGG - Intronic
1152137049 17:78510648-78510670 ATTTTCAGCTCTGAGACTTGAGG + Intronic
1152166337 17:78710047-78710069 CCTTCCAGCTGGGAGACTTCAGG + Intronic
1152813409 17:82392887-82392909 CCTTCCAGATCTGACACTTTAGG + Intronic
1156244757 18:35287605-35287627 CCATACAACTCTGAGATTTAGGG - Intronic
1159467582 18:68804495-68804517 CGCTCCAACACTGAGACTTCAGG - Intronic
1160383458 18:78478542-78478564 CCCTCCATCTCTGACACTTAGGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162057125 19:8071488-8071510 CCTTCCCTGTCTGAGCCTTGGGG - Intronic
1163249687 19:16119111-16119133 CGGTCAAACTTTGAGACTTGAGG - Intronic
1165660458 19:37575092-37575114 CTTCAGAACTCTGAGACTTGAGG - Intronic
1166036656 19:40173152-40173174 CTTTCCAACTCTGAGGACTGTGG + Intergenic
1166669538 19:44701556-44701578 CCTTCCCTCTCTCAGACTGGGGG - Intronic
1166778576 19:45327580-45327602 CCTTCCAGCTGTGTGACTTTGGG - Intergenic
1167350921 19:48974224-48974246 CCCTCCTACTATGAGCCTTGGGG - Exonic
1167742044 19:51329570-51329592 CCATCCAACTGTCAGACTGGTGG + Exonic
925108044 2:1309833-1309855 ACTTCCCACTCTGTGACTTTAGG - Intronic
925950941 2:8910677-8910699 CCTTTCTACTTTGAGAGTTGGGG - Intronic
926787366 2:16531367-16531389 CCTTCCAGCTCCGAGAGTTTAGG + Intergenic
927062456 2:19436738-19436760 CCTCTCATCTCTGAGACTGGAGG - Intergenic
927187790 2:20494665-20494687 TCTTTCAACTCTGTGATTTGGGG - Intergenic
928449841 2:31368394-31368416 CCTTTCAACCCTGGGATTTGGGG - Intronic
928978608 2:37115666-37115688 CCTTCCAACTTTGAGATTCTCGG + Intronic
928999474 2:37332017-37332039 CCTGCCAACTCCGAGACTAATGG - Intergenic
931177069 2:59864854-59864876 CCTTCCACATCTGAAGCTTGGGG + Intergenic
931296746 2:60934896-60934918 CCTTCCACCCCTGGGACTTCAGG - Intergenic
932842607 2:75097625-75097647 CCTTCCTATTCTCAGTCTTGGGG + Intronic
933646354 2:84815827-84815849 CCATCTCACTTTGAGACTTGTGG + Intronic
934867311 2:97824653-97824675 CCTTCCAATGCAGAGACTTCAGG - Intronic
938678998 2:133670116-133670138 CTTACCAGCTCTGTGACTTGGGG + Intergenic
938962024 2:136352604-136352626 TCTTCCATCTCAGAGACTGGAGG + Intergenic
939270029 2:139927551-139927573 CCATCCAACTCTGACACTTTTGG - Intergenic
941354801 2:164477378-164477400 CTTACCAACTCTGTGACTTTGGG - Intergenic
941626261 2:167833925-167833947 ACTTCCAACGCTGAAATTTGAGG + Intergenic
941921152 2:170852126-170852148 CTTCCCAACTCTGTGACTTTGGG + Intronic
943341985 2:186693284-186693306 TCTTCCAATTCTGAGACCTCTGG + Intergenic
945100959 2:206261835-206261857 CCTTTCAACTTTGAGTCTGGTGG + Intergenic
946043421 2:216802098-216802120 CCTGCCAATTAGGAGACTTGAGG + Intergenic
946960544 2:224980440-224980462 CCTTCAAACTTTGCAACTTGGGG + Intronic
947041488 2:225926348-225926370 GCTTCCTTCTCTGAGACTAGAGG + Intergenic
947279937 2:228440169-228440191 CCTTCTATTTCTGAGCCTTGTGG + Intergenic
947568109 2:231208748-231208770 CCTTCTAACCCTGAGAGTTGAGG - Intronic
947932937 2:233978943-233978965 CCTTCCACATCTGAGACTGTAGG + Intronic
948247692 2:236500274-236500296 CATTCAAACTCTGTGACTTTGGG - Intronic
948792743 2:240387828-240387850 CCTTCCAGCTCTGGGACTCTGGG - Intergenic
1168891714 20:1299334-1299356 CCATCCAACTCTGCTCCTTGAGG - Intronic
1172408801 20:34707633-34707655 CCTACTAGCTCTGAGACTTTGGG + Intronic
1172413208 20:34741953-34741975 CCTTCCTACTCTGGGAATTCTGG + Exonic
1172532953 20:35646310-35646332 CCTTCCCACTGTGTGACTTGTGG + Intronic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1174086800 20:48014650-48014672 TCTTCGAAATCTGAGACTGGGGG + Intergenic
1174597752 20:51698133-51698155 TGTTCTAACTCTGAGACTTTGGG - Intronic
1177189621 21:17835937-17835959 GCTTCCAACTTTGAGATTTTTGG - Intergenic
1180705730 22:17808700-17808722 CCCTTCATCTCTGAGATTTGGGG - Intronic
1182476131 22:30577351-30577373 CCTTCCAGCTCTGGGAGTTTAGG - Intronic
1182876915 22:33700216-33700238 CCTGCTAACTCAGACACTTGGGG + Intronic
1184848419 22:47103196-47103218 CATTCCTACTCTTAGTCTTGGGG + Intronic
950111273 3:10420305-10420327 CCTTCCAGCTCTGTGACCTTGGG + Intronic
951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG + Intronic
952216220 3:31280191-31280213 CTTTCCAACTCTGCGACATTGGG + Intergenic
952739895 3:36724936-36724958 AATTCCAACTCCAAGACTTGAGG + Intronic
953957074 3:47239972-47239994 CATTCCAACTCTGGGACAGGTGG - Intronic
956361649 3:68454383-68454405 CCTTCCCACTCTCAGATTTTAGG + Intronic
956691091 3:71878089-71878111 CATTACAACTCTGAGAGTTCTGG - Intergenic
958235735 3:90984873-90984895 ATATTCAACTCTGAGACTTGAGG - Intergenic
958240288 3:91061325-91061347 ATATTCAACTCTGAGACTTGAGG - Intergenic
961093135 3:124132668-124132690 CCTTGTAACTCAGAGAATTGGGG + Intronic
962304279 3:134272036-134272058 CCTTCCAACTCTGTGACTCCAGG + Intergenic
963431574 3:145212541-145212563 CCTGCAAACTCTCAGACTTAAGG - Intergenic
965314011 3:167167745-167167767 CCTTCCATCTCAGGGACTAGGGG - Intergenic
965654339 3:170967959-170967981 CCTTCCAATTCTGAGAATGATGG - Intergenic
966909361 3:184550210-184550232 CCTTCCAACATTGAAACTTCCGG + Intronic
967424041 3:189305766-189305788 CCTTCCAACTCAGATAGTTTAGG + Intronic
968173560 3:196529284-196529306 CCTTCCCAGTGTGAGAGTTGGGG + Intergenic
969422647 4:7106339-7106361 CCTGCCATCTCTGAGGCTGGTGG + Intergenic
970303527 4:14706393-14706415 ACTTAGAACTCTCAGACTTGAGG + Intergenic
971954069 4:33393008-33393030 TCTTCCAACTCTTAGACATCTGG - Intergenic
974169870 4:58252301-58252323 TCTTCCAACCCTCAGACTTCAGG - Intergenic
974927448 4:68317924-68317946 CTTCCCAACTCTGTGACTTTGGG - Intronic
975677746 4:76843867-76843889 CTTACCAGCTCTGTGACTTGGGG - Intergenic
976870299 4:89784390-89784412 CCTTCCAACACCGGGACTGGCGG + Intronic
979404720 4:120295388-120295410 CCTTCCTACTCTGTGGCTTAGGG + Intergenic
982718688 4:158837173-158837195 GCTTCCCACTCTGCGACTTCTGG - Intronic
983724310 4:170901368-170901390 CTTTCAAACTATGAGACCTGGGG - Intergenic
984656335 4:182322614-182322636 GCTTCCAACTTGGAGCCTTGTGG - Intronic
985301643 4:188496385-188496407 CCTCCCAGCTCTGAGCTTTGGGG + Intergenic
986500276 5:8391082-8391104 CCTTCTAACTCTCAGAGTTGGGG - Intergenic
988884367 5:35539484-35539506 CCTTCCCACTCTAAGGATTGAGG + Intergenic
989496339 5:42114427-42114449 CCTTCCAATTCCCAGACTTCAGG - Intergenic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
997356659 5:133266991-133267013 CCCTCCACCTGTGTGACTTGTGG - Intronic
997471076 5:134117248-134117270 CCTTCCAAGTCTGTGAGATGGGG + Intronic
1000193489 5:158936349-158936371 CCTGCCACCTCTGTGACTTCAGG + Intronic
1000422664 5:161056223-161056245 CCTGCTAACTCAGAGACATGAGG + Intergenic
1001015014 5:168132814-168132836 CCTTCCAAGTCTGTGACTCTGGG + Intronic
1001685983 5:173595475-173595497 CTTACCAGCTCTGAGATTTGGGG + Intergenic
1001779490 5:174355635-174355657 CCTTCCAAATCTGACATTTATGG + Intergenic
1004399470 6:15275068-15275090 ACCTCCATCTCTGTGACTTGGGG + Intronic
1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG + Intergenic
1006690356 6:35878636-35878658 CCACCCGACTCTGATACTTGGGG - Intronic
1006738184 6:36290017-36290039 CCTTCCAACTTTGAGATTCTGGG - Intronic
1006949902 6:37813100-37813122 CCTACTAGCTCAGAGACTTGAGG - Intergenic
1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG + Intergenic
1007871839 6:45049243-45049265 GCTTCCAACCCTGAGACTTCTGG + Intronic
1008360281 6:50609346-50609368 CCTCACAACTCTGAGCCTTAAGG + Intergenic
1009340586 6:62549621-62549643 CATCCCAACTCTGTGCCTTGAGG + Intergenic
1012335620 6:98053022-98053044 CCTTCCAAGACAGAGACTTTTGG - Intergenic
1012817221 6:104039395-104039417 GCTCCCAACTTTGAGACTTCTGG - Intergenic
1015099124 6:129453855-129453877 CTTTCTCACTCTGATACTTGTGG - Intronic
1016705419 6:147101358-147101380 CCTTCCGAATTTGAGACTTATGG + Intergenic
1017851064 6:158306447-158306469 CCTTCCACCTCAGACTCTTGAGG - Intronic
1018740706 6:166726479-166726501 CCTTCCATGTCTCTGACTTGGGG - Intronic
1021050478 7:15977711-15977733 CCTTCCGACTCTGAGATATTGGG + Intergenic
1021789971 7:24194913-24194935 TCTTTCAAATGTGAGACTTGAGG + Intergenic
1022338131 7:29442555-29442577 CCATCCCACTCTGAGAGTTCAGG + Intronic
1022945564 7:35280419-35280441 CCATCCCACTGTGAGAATTGAGG + Intergenic
1023630640 7:42160576-42160598 GCTTCCAAATCTGAAACTTTGGG - Intronic
1024002784 7:45202064-45202086 CCTTCCAGCTCTGACAATTTGGG - Intergenic
1025776917 7:64568596-64568618 CCATCCAACTGTCAGACTGGTGG - Intergenic
1026254829 7:68701855-68701877 CTTCCCAACTCTTAAACTTGTGG + Intergenic
1027791269 7:82640655-82640677 CCTTCCAATGCTCAGACTTCAGG - Intergenic
1028104104 7:86856883-86856905 CCTCCCAGCTCTGATATTTGTGG - Intronic
1028301050 7:89201417-89201439 CCTTCCAATGCTGACACTTTTGG - Intronic
1028986340 7:97011963-97011985 CCTTCCTACTGTGAAACTTTGGG + Intergenic
1029989318 7:104948593-104948615 CCTTGCATGTCTGAGACTTTAGG - Intergenic
1031701813 7:124935531-124935553 ACAGCCAACTCTGAGTCTTGAGG - Intergenic
1031889725 7:127280005-127280027 CCTTCCCACTCTGATATTTTAGG + Intergenic
1032387220 7:131533261-131533283 CCTGGCAGCTGTGAGACTTGGGG + Intronic
1032699763 7:134369212-134369234 GCTTCCAACTCAGAGAGCTGAGG + Intergenic
1034027657 7:147724422-147724444 CCCTGCAACTGTGAGGCTTGAGG - Intronic
1034479095 7:151306194-151306216 ACTTTCAACTCTGAGAATTCAGG + Intergenic
1035313144 7:157982672-157982694 CCCTCCATCTCTGTGACTCGGGG - Intronic
1036067568 8:5399602-5399624 CCTTCCTACTCTGATATTTTAGG - Intergenic
1037660578 8:20923026-20923048 CCTTCCAAATCTGAGCCTCTGGG - Intergenic
1037865279 8:22438397-22438419 CCTACCAGCTCTGTGACTTTGGG + Intergenic
1038482954 8:27914365-27914387 CCTTCTAGCTCTGAGATTTGGGG - Intronic
1038932945 8:32215583-32215605 CCTTACAACTGTGAGACCTTGGG - Intronic
1039406665 8:37318812-37318834 CCATTCAACTATCAGACTTGAGG - Intergenic
1039790290 8:40870341-40870363 CCCACCAAATATGAGACTTGAGG - Intronic
1040536461 8:48315319-48315341 CGTCCCAACTCTGTGAGTTGGGG - Intergenic
1044005285 8:86930947-86930969 CCTTCCAAGTCCTAGACTTCAGG + Intronic
1044847045 8:96392282-96392304 CCTTCCAACACTAAGACTCTAGG - Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1046865930 8:119150275-119150297 CTTTCCAAGACTGAGAATTGAGG - Intergenic
1047785598 8:128151406-128151428 CTTTCCTACTCAGAGACTGGTGG - Intergenic
1048563675 8:135570681-135570703 CCTTCCAACTCTGTGCCTACTGG + Intronic
1050139231 9:2500184-2500206 CCTGCCAACCCTTTGACTTGTGG + Intergenic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1053793671 9:41705367-41705389 CCTTCCACCTCTCAGATTTATGG + Intergenic
1054151503 9:61609463-61609485 CCTTCCACCTCTCAGATTTATGG - Intergenic
1054182082 9:61917381-61917403 CCTTCCACCTCTCAGATTTATGG + Intergenic
1054471277 9:65540602-65540624 CCTTCCACCTCTCAGATTTATGG - Intergenic
1056512466 9:87319005-87319027 CCAGCCAACTGTGAGAATTGAGG - Intergenic
1057912607 9:99031625-99031647 CCTTCCAGCTCTGAAACTTTGGG - Intronic
1059225491 9:112669196-112669218 CCTTCCAACGCTGACACTCTAGG - Intronic
1059590858 9:115659964-115659986 CCTTTCAACTCTGACATTTGGGG + Intergenic
1059717137 9:116923731-116923753 TCTTCCAAGTCTGAGATTTAAGG - Intronic
1059820962 9:117971471-117971493 CCTTTCAAAGGTGAGACTTGGGG + Intergenic
1060030715 9:120212650-120212672 CCTTCCAACCCTGAGATTAATGG + Intergenic
1060325309 9:122608830-122608852 ACTCCCAGCTCTGAGTCTTGGGG - Intergenic
1185563833 X:1080960-1080982 GATTCCAAGTTTGAGACTTGGGG - Intergenic
1186003401 X:5040463-5040485 CCTACCAACTCAGATATTTGAGG - Intergenic
1190119034 X:47645400-47645422 ACTTCCAGCTGTGTGACTTGGGG - Intronic
1192161213 X:68789332-68789354 CATTCCAGCTCTGAGAGTTTTGG + Intergenic
1193663291 X:84283626-84283648 CCTTCCAACTCTAAGATTCTTGG - Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1198152207 X:133922372-133922394 CTTTCCAGCTCTGAGAATGGAGG + Intronic
1201631388 Y:16074826-16074848 CCTTCCAATGCTCAGACTTCAGG - Intergenic