ID: 997361247

View in Genome Browser
Species Human (GRCh38)
Location 5:133296519-133296541
Sequence GTCTGATGGTAGGAGTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997361247_997361256 0 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361256 5:133296542-133296564 CTATTTTTACCTAGGGGGCTAGG 0: 1
1: 0
2: 0
3: 5
4: 101
997361247_997361258 27 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361258 5:133296569-133296591 ATCTTCCCCCAGTGACTGCGTGG No data
997361247_997361254 -5 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361254 5:133296537-133296559 CAGACCTATTTTTACCTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
997361247_997361253 -6 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361253 5:133296536-133296558 TCAGACCTATTTTTACCTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 92
997361247_997361251 -8 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361251 5:133296534-133296556 CATCAGACCTATTTTTACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 124
997361247_997361252 -7 Left 997361247 5:133296519-133296541 CCATACCACTCCTACCATCAGAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 997361252 5:133296535-133296557 ATCAGACCTATTTTTACCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997361247 Original CRISPR GTCTGATGGTAGGAGTGGTA TGG (reversed) Intronic
901717404 1:11167556-11167578 GTCTGAGGGTAGGAGATGTGGGG + Intronic
905286666 1:36884856-36884878 GTGTAATGGTAGCAGTGGCAGGG - Intronic
906925378 1:50110347-50110369 GTCTCATGCTAGGAGTGATGGGG + Intronic
909885373 1:80935717-80935739 GGCTGAGGGTAGGAGTGGGATGG - Intergenic
912256946 1:108069878-108069900 GGCTGATGGTGGGAGTGAGAGGG - Intergenic
915448823 1:155990547-155990569 GACTGAGGGTGGGAGTGGGAGGG - Intronic
919425097 1:197420027-197420049 GTCTGATGTTAGAAGTGCTTTGG + Intronic
922502052 1:226104527-226104549 TTCTGATGGTGGGATAGGTAAGG + Intergenic
922536027 1:226381545-226381567 GTCGGATGGGAAGAGGGGTAAGG + Intronic
924518110 1:244782786-244782808 GTTTGATGGCAGTAGTGCTAAGG - Intergenic
924908422 1:248482048-248482070 GTCTGTTGCTGGGAGTTGTATGG + Intergenic
924915688 1:248566037-248566059 GTCTGTTGCTGGGAGTTGTATGG - Intergenic
1065997445 10:31071967-31071989 GTCTGATGGGAGAAGTAGGAGGG + Intergenic
1074026756 10:109644000-109644022 GTTTGTTGGTAGGAGAGGGACGG - Intergenic
1077264405 11:1641903-1641925 GTCTGAGGGTGGGGGTGGTCTGG - Intergenic
1077949666 11:6942662-6942684 CTCTGCTGGAAGGAGAGGTAGGG - Intronic
1078696430 11:13636870-13636892 GTCTCATGGCAGGAATGGTTTGG + Intergenic
1080415863 11:32069424-32069446 GACTGATGGGAGGTGTGGCATGG + Intronic
1082201082 11:49368484-49368506 GTCTGATGATGGTAGTGGTAGGG - Intergenic
1086368211 11:86129941-86129963 TTCTGACTGTAGGAGTGGTAGGG + Intergenic
1086654593 11:89337727-89337749 TTCTGATGGTGGTAGTGGTAGGG + Intronic
1088113933 11:106295373-106295395 GGCTGATTCTAGGAGTGCTAAGG + Intergenic
1088774064 11:113065003-113065025 TTCTGATGCTAGGACTGGTGGGG + Intronic
1089583199 11:119494446-119494468 GTCTGATGGTGAGGGCGGTAGGG - Intergenic
1090629006 11:128629919-128629941 GTCAGATAGTAGGTGTGGCAAGG + Intergenic
1090805773 11:130201242-130201264 GGCTGAAGGAAGGAGTGTTAGGG + Intronic
1091668802 12:2438016-2438038 GTATGATGGTAGTGGTGGTGAGG + Intronic
1093527400 12:20117942-20117964 TTATGATGGGAGGATTGGTAAGG + Intergenic
1094502922 12:31036619-31036641 GTCTTCTGGTTGGAGTGGCAGGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097049571 12:56213927-56213949 GTCTGATGGCAGGTTTGGTGGGG - Intronic
1104354438 12:128072823-128072845 GCCAGATGGTAGGTGGGGTATGG - Intergenic
1105533773 13:21244853-21244875 GTATAATGGCAGGAGTGGAACGG + Intergenic
1106490452 13:30216670-30216692 GGCTGGTGGCAGGAGGGGTAGGG + Intronic
1107148735 13:37088177-37088199 GTCTGATGGTTGGAATTGCATGG + Intergenic
1108745919 13:53393598-53393620 GTCCCATGGTAGAGGTGGTAGGG + Intergenic
1110804410 13:79737214-79737236 GTCTGAAGGTACCAGTGGGATGG + Intergenic
1115432740 14:33340007-33340029 ATCTGATGGTTGGACTGGTTTGG + Intronic
1117696998 14:58375836-58375858 GTTTGAAGGCAGGGGTGGTATGG + Intergenic
1117993578 14:61458357-61458379 GTCTGGTGGTAACAGTGCTACGG + Intronic
1119109477 14:71958112-71958134 GTCTTAAGGTAGGATTGGAATGG + Intronic
1119781940 14:77281767-77281789 GGTTGAGGGTAGGAGTGCTACGG - Intronic
1120892066 14:89500240-89500262 GGCTCATGGAAGGAGTGGGAAGG - Intronic
1123626291 15:22229009-22229031 GGCTGATGGTATGAGTTGTATGG - Intergenic
1128518304 15:68358085-68358107 GGAAGATGGTAGGAGAGGTAAGG - Intronic
1129670324 15:77604373-77604395 GGCTGAGGGCAGGAGTGGCAGGG - Intergenic
1130883504 15:88074716-88074738 GTTTGATGGTAGAAATGGGATGG - Intronic
1131797586 15:96035218-96035240 GTCTGTTGGCAAGAGTGGAAGGG - Intergenic
1136284603 16:29233607-29233629 GTCTGAAGCTCGGAGTGGGAAGG + Intergenic
1136284614 16:29233652-29233674 GTCTGAAGCTCGGAGTGGGAGGG + Intergenic
1138167236 16:54814409-54814431 CTCTGAAGATAGGAGGGGTATGG + Intergenic
1138644970 16:58418063-58418085 GTCTGAAGTCAGGAGTGGAATGG + Intergenic
1141977682 16:87528362-87528384 GGCTGATGGTATGAGTTGTATGG + Intergenic
1142089635 16:88203120-88203142 GTCTGAAGCTCGGAGTGGGAAGG + Intergenic
1142502367 17:340165-340187 GTCTGATGGCAGGATTGGCCGGG - Intronic
1144331265 17:14226253-14226275 GTCTGATGGTAGCAGGAGAAAGG - Intergenic
1144335633 17:14266715-14266737 GTATGAAGGTAGGAGTAGTTGGG - Intergenic
1145053009 17:19678790-19678812 GTCTGCTGGTAGGAGCTGAAAGG + Exonic
1145800217 17:27677821-27677843 GTCTCTTTGTAGGAATGGTATGG + Intergenic
1146607492 17:34273363-34273385 GTTTGATGGTAGGACAGGAAAGG + Intergenic
1147444531 17:40466776-40466798 GGCTGATGGGAGGGGTGGGACGG + Intergenic
1148083057 17:44977993-44978015 GTCTGATGATGGCAGTGGCATGG - Intergenic
1148726181 17:49792054-49792076 GCCAGATGTGAGGAGTGGTAAGG - Intronic
1157012244 18:43664578-43664600 GTCTGATGGTAATAGTGTTATGG + Intergenic
1157304525 18:46507484-46507506 ATTTGACGGTTGGAGTGGTAAGG + Intronic
1162318620 19:9957251-9957273 GGCTGGTGGCAGGAGTAGTAGGG + Intergenic
1166475498 19:43121118-43121140 GTCTGATGGTAGTGGGGGTGGGG + Intronic
926867940 2:17380132-17380154 GCCTGCTGGTGGGAGTGGGAGGG - Intergenic
934165742 2:89292766-89292788 GTCTGAAGGTTGGAGTATTAGGG + Intergenic
934201535 2:89889690-89889712 GTCTGAAGGTTGGAGTATTAGGG - Intergenic
940567607 2:155387745-155387767 GACGGATGGAAGGAGTGGTTGGG - Intergenic
941412777 2:165180507-165180529 GTCTTATGGTGGTAGTGGTTGGG + Intronic
942292778 2:174487981-174488003 TTCTGATGTTAAGAGTCGTAAGG + Intergenic
942313257 2:174675838-174675860 GTGTGAGGGGAGGAGTGGGAGGG + Intronic
943916717 2:193644242-193644264 AGCTGATGGTGGTAGTGGTAGGG + Intergenic
944526540 2:200625434-200625456 GTCTGCTGGTTGAAGTGGTGAGG - Intronic
944924452 2:204450032-204450054 GTCTGATGGTAACAGAGCTAAGG - Intergenic
946093761 2:217253795-217253817 ATCTGAGGCTAGGAGTGTTAGGG + Intergenic
948293865 2:236846825-236846847 GCCTGATGGCAGGAGGGGGAGGG + Intergenic
948853863 2:240721146-240721168 GGCTGCTGGTAGGAGGGGTGGGG - Intronic
1169582455 20:7039239-7039261 TTCAGAGGCTAGGAGTGGTATGG + Intergenic
1174326698 20:49784833-49784855 GTTAGATGGTATGAGTGCTACGG - Intergenic
1175104963 20:56608526-56608548 CCCTGATGGTAGAAATGGTATGG - Intergenic
1176012090 20:62903384-62903406 TTCTGATGGTATGTGTGGTGAGG + Intronic
1178601332 21:33997218-33997240 GTATGGTGGTAAGAGTGGTAAGG - Intergenic
1181553345 22:23653437-23653459 GTCTGATGGTAGCAGGGGCATGG + Intergenic
1185346010 22:50311095-50311117 GTCTGAGGGTCTGAGTGGTCAGG + Exonic
950427977 3:12934942-12934964 GTCTGGGGGTAGGAGTGCTCAGG - Intronic
950688875 3:14639803-14639825 GTCACATGGTAGAAGGGGTAAGG + Intergenic
953963836 3:47286799-47286821 GCCTTATGGTAGGAGAGGTCTGG + Intronic
955419999 3:58726519-58726541 TTCTGATGGTGTGAGTGGAAGGG - Intronic
955420009 3:58726601-58726623 TTCTGATGGTGTGAGTGGAAGGG - Intronic
955420051 3:58726970-58726992 TTCTGATGGTGTGAGTGGAAGGG - Intronic
956716170 3:72081932-72081954 GTGTGATGGTAGGAGTGAGATGG - Intergenic
958547392 3:95572164-95572186 GTATGATGGTATGTGTGGTGGGG + Intergenic
961581778 3:127889011-127889033 TTTTGATTCTAGGAGTGGTAAGG - Intergenic
962047670 3:131777761-131777783 TTATGAATGTAGGAGTGGTAAGG + Intronic
964505596 3:157395508-157395530 GTGTGATGACAGGAGTGGTTGGG + Intronic
965149705 3:164954905-164954927 GTATGATGGTATTAGTGATATGG + Intergenic
969362019 4:6670749-6670771 GTCTCTTGGTATGAGTGGAATGG - Intergenic
977377300 4:96222191-96222213 GTCTGCTGGTAGGAGGGTGATGG - Intergenic
978337743 4:107688086-107688108 ATGTGAAGGTAGGAGTGGCAGGG - Intronic
981581247 4:146250410-146250432 GTCTGATGGCAGTAATGGCAAGG - Intergenic
982336352 4:154243542-154243564 CTCTGAAGGTAGGAGTGAAATGG - Intronic
983378853 4:166965994-166966016 GTCTGAAGGAAGGAATGGAAAGG - Intronic
986791608 5:11166586-11166608 GGTTGATGGTGGGAGTGGGAGGG + Intronic
987393028 5:17394484-17394506 ATCTGATGGGAGGAGTGGCATGG + Intergenic
987547534 5:19332320-19332342 GAATGATGGAAGGAGTGGTTGGG - Intergenic
988810740 5:34782745-34782767 GTCAGATGGTAGAAATGATAAGG - Intronic
997361247 5:133296519-133296541 GTCTGATGGTAGGAGTGGTATGG - Intronic
999917128 5:156274912-156274934 GTTTCATGGTAGGTTTGGTAAGG + Intronic
1003377303 6:5591692-5591714 GTATAATGGCAGGAGTGGGAAGG - Intronic
1003613314 6:7632448-7632470 GTGTGATGGAAGTAGTGCTATGG + Intergenic
1003983572 6:11412902-11412924 GTCTGATGACAGGAGGGGCATGG + Intergenic
1006652297 6:35561629-35561651 TTTTGATGGTAGGAGAGGTGAGG + Intergenic
1008506484 6:52235959-52235981 GTCTGTTGGTGGGTGTGGAATGG - Intergenic
1009801837 6:68547643-68547665 GGGTGAGGGTGGGAGTGGTAGGG + Intergenic
1010855364 6:80831399-80831421 GTATGATGATATGAGTCGTAGGG + Intergenic
1011652013 6:89515481-89515503 TACTGGTGGTAGGATTGGTATGG + Intronic
1012252408 6:96993345-96993367 GGCTGTTGGTTGGGGTGGTAAGG + Intronic
1012674516 6:102098684-102098706 GTCAGATGGTAGTAGAAGTATGG + Intergenic
1019322671 7:422765-422787 GTCTGATGCTGGGAGTGTTGGGG - Intergenic
1022749463 7:33208620-33208642 GGCTGATGGTAGAAGTGCCATGG + Intronic
1026486379 7:70825352-70825374 GTCTGAGGGTAGGACTGGTCCGG - Intergenic
1028981240 7:96970225-96970247 GTTTGATGGTTGGTGTGGGATGG - Intergenic
1031597991 7:123669774-123669796 ATCAGATTGTAGGAGTGGTGTGG + Intergenic
1033427388 7:141256492-141256514 GGCTGAAGGTGAGAGTGGTAAGG + Intronic
1037396962 8:18453447-18453469 GTATGATGGCAGGACTGGTTGGG - Intergenic
1038242206 8:25820210-25820232 GTATGATGGGAGTAGTGGTGGGG - Intergenic
1043928577 8:86065365-86065387 GTCTGGTGGGAGTAGTGTTAGGG + Intronic
1046660877 8:116947351-116947373 ATCTGATGTTTGGAGTGGTCTGG + Intergenic
1048106304 8:131413989-131414011 CTGTGATGGTAGTAGTGGAATGG - Intergenic
1048291693 8:133186122-133186144 GTCTGCTGGTGGGAGTTGGAGGG + Intergenic
1050900527 9:10942480-10942502 GTCAGATGGGAGGAGTGGACTGG + Intergenic
1059906200 9:118989691-118989713 GTCTGATGGCAGGAGTGTAGGGG + Intergenic
1059918445 9:119130541-119130563 GTCTAATGGTAATAATGGTAAGG + Intergenic
1060124590 9:121030665-121030687 CTCTGATTGTTGGAGTGGGAAGG - Intronic
1186185089 X:7012925-7012947 GTCTGATGGTAGTGGGGGTGGGG + Intergenic
1186577359 X:10780411-10780433 CTCTGATGGTGGGAGGGGTGTGG + Intronic
1186701307 X:12093062-12093084 GCTTAATTGTAGGAGTGGTAAGG + Intergenic
1187231857 X:17431083-17431105 GTCTGAAGTTAGGAAAGGTAGGG + Intronic
1193433491 X:81441741-81441763 ATCTGATGGTAGTAGTTGTATGG + Intergenic
1193597386 X:83463192-83463214 GGGTGAAGGTAAGAGTGGTAAGG - Intergenic
1197103546 X:122686007-122686029 TTCTGATGCTGGTAGTGGTAGGG - Intergenic