ID: 997361892

View in Genome Browser
Species Human (GRCh38)
Location 5:133300456-133300478
Sequence CCCCTACTGTGCCCTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997361884_997361892 28 Left 997361884 5:133300405-133300427 CCTGTTTGTTCTGTCTGAGCCAA 0: 1
1: 0
2: 1
3: 19
4: 182
Right 997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG 0: 1
1: 0
2: 0
3: 21
4: 230
997361883_997361892 29 Left 997361883 5:133300404-133300426 CCCTGTTTGTTCTGTCTGAGCCA 0: 1
1: 0
2: 3
3: 32
4: 360
Right 997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG 0: 1
1: 0
2: 0
3: 21
4: 230
997361886_997361892 9 Left 997361886 5:133300424-133300446 CCAACCAGGAGTCGACTCCACTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG 0: 1
1: 0
2: 0
3: 21
4: 230
997361888_997361892 -8 Left 997361888 5:133300441-133300463 CCACTGCCCTTAAATCCCCTACT 0: 1
1: 0
2: 1
3: 20
4: 195
Right 997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG 0: 1
1: 0
2: 0
3: 21
4: 230
997361887_997361892 5 Left 997361887 5:133300428-133300450 CCAGGAGTCGACTCCACTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG 0: 1
1: 0
2: 0
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997361892 Original CRISPR CCCCTACTGTGCCCTGAGCA TGG Intronic
900224682 1:1527398-1527420 CCCCTGCTGTGCTGGGAGCAGGG - Intronic
900667028 1:3822500-3822522 CCCAAACTGGGTCCTGAGCAGGG + Intronic
901004220 1:6164050-6164072 CACATGCTGTGCCCTCAGCAGGG - Intronic
901054993 1:6445246-6445268 CCCTGACCGTGCCCTGAGCATGG + Intronic
901490167 1:9592642-9592664 CCACTCCAGAGCCCTGAGCACGG - Intronic
902479369 1:16703367-16703389 CCCTGACCGTGCCCTGAGCATGG - Intergenic
903781355 1:25821926-25821948 CCCCTACGGTGCCCAGCACAAGG + Intronic
904601312 1:31674144-31674166 CCCATGCTCTGCCCTGACCAAGG + Intronic
905170693 1:36107989-36108011 CCCCCACTCTGCCCTGTACAGGG + Intronic
905417431 1:37813633-37813655 CCCTTTCCTTGCCCTGAGCAAGG - Exonic
905878576 1:41449029-41449051 CCCTCACTGTGACCTGAGCCGGG - Intergenic
906128659 1:43442879-43442901 CCCCCGCTGAGCCGTGAGCAGGG + Exonic
906151080 1:43588129-43588151 CCCAGGTTGTGCCCTGAGCATGG + Intronic
906685937 1:47763407-47763429 CCCCTAATATGCCCAGAGGAGGG + Exonic
907147851 1:52252783-52252805 CCCCTACTGCACCAGGAGCATGG + Intronic
907193710 1:52669284-52669306 CCCCTACAGGGCACTGAGCTAGG + Intronic
908772381 1:67608894-67608916 TCCCTGCTGTCCCCTGAGCCTGG + Intergenic
910205759 1:84747491-84747513 CCTCTCCTGTGCCCTGAGGCAGG - Intergenic
910207178 1:84759601-84759623 CCCCAATTGTTCCCTGAACATGG + Intergenic
910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG + Intronic
914332554 1:146685765-146685787 CCCCTTCTGTGCCCCGATGATGG - Intergenic
919913900 1:202128548-202128570 CCCCTACTGGGGCCTCAGCAAGG - Exonic
919920904 1:202165900-202165922 CCCTGGCTGTGGCCTGAGCAGGG + Intergenic
920636125 1:207705431-207705453 CCTCCACTGTGTGCTGAGCAAGG - Intronic
920711844 1:208302821-208302843 CCTGTACTATGCCCTAAGCAGGG - Intergenic
920975674 1:210783039-210783061 CCCCTACTATGTTCTAAGCATGG - Intronic
922991453 1:229916469-229916491 CCCATGCTGTGGCCTGTGCAGGG + Intergenic
924770371 1:247074703-247074725 ACCCTACTGTGAACTGTGCATGG - Intronic
1063199728 10:3776286-3776308 TCCCTACTGTGCCCACAGCCGGG + Exonic
1065312594 10:24430704-24430726 ACCCTACTGTGAACTGCGCATGG - Intronic
1068282419 10:54891879-54891901 TCACTACTGTGCCCTAATCAAGG + Intronic
1069995037 10:72336735-72336757 CCCCTAGAGTGCCCTGGGCATGG - Intronic
1070797941 10:79227982-79228004 CCCTGTCTGTGCCCTGGGCAAGG + Intronic
1072088755 10:92106324-92106346 CCAGTACTGTGCCTTGACCACGG + Intronic
1074252287 10:111763149-111763171 GATCTACTCTGCCCTGAGCAAGG - Intergenic
1075301069 10:121324708-121324730 GCCCTACTGTGAACTGTGCATGG - Intergenic
1075552171 10:123400749-123400771 CCCCTACTCCACCCTGGGCATGG - Intergenic
1075674832 10:124289259-124289281 GCCCTGCTGTGATCTGAGCAGGG + Intergenic
1076534421 10:131167646-131167668 CCCCTCCTGTCCCCTTGGCAGGG - Intronic
1077674612 11:4185231-4185253 CTCCTACTGTGTGCTGAGCTTGG + Intergenic
1080714267 11:34783589-34783611 TTCCTACTGTGCCCTGAGGTTGG - Intergenic
1081701045 11:45153070-45153092 CCCCTACTTTTCCCTGGGAATGG - Intronic
1083340289 11:61954952-61954974 CCCCTCCTGAGGCCTGAGCCAGG - Intronic
1083767394 11:64848364-64848386 TCCCCACAGAGCCCTGAGCATGG + Intergenic
1084590136 11:70085608-70085630 CCCCAACTGTCCCCTAACCAGGG + Intronic
1086783148 11:90931654-90931676 CCACTGCTGTGCCCTGTGCCAGG - Intergenic
1086951396 11:92894037-92894059 CCCCTACACTGCCTTGAGCATGG + Exonic
1088602553 11:111494198-111494220 ACCCTCCTGTGCTCTCAGCAGGG - Intronic
1088918847 11:114247131-114247153 GCCCTACTGTCCCCTGAAGAGGG + Intronic
1090637027 11:128695475-128695497 CTCTTGCTGAGCCCTGAGCAGGG - Intronic
1092938414 12:13385553-13385575 CCCCTGCTGTGCCCTGATCCAGG - Intronic
1094566181 12:31600268-31600290 CCCCTTCGGTGGCCTGAGCCAGG - Intergenic
1096079302 12:48823187-48823209 CCCCTCCTATCCCCTGAGAAGGG - Intronic
1096839474 12:54371515-54371537 GCTCTACTGTGCTCTGTGCAAGG - Exonic
1103902147 12:124308864-124308886 CCCCTAGGGTGGCCTGTGCAGGG + Intronic
1104631341 12:130405457-130405479 CCCCCACTGGGCTCTGCGCAGGG + Intronic
1106869493 13:34003316-34003338 CCGCCACGCTGCCCTGAGCATGG + Intergenic
1107029817 13:35839163-35839185 CCCCTACAGAGCTCTCAGCATGG - Exonic
1107043904 13:35975629-35975651 GCACGACTGTGCCCTGAGCACGG + Intronic
1108708325 13:53010134-53010156 CCCCCACAGTGCCCAGAACATGG + Intergenic
1110300571 13:73921825-73921847 CCTATACAGTGCCCTGAGGATGG + Intronic
1110628153 13:77674998-77675020 CCCCTACTGTGCCTTTCTCATGG - Intergenic
1113599531 13:111558647-111558669 ACCCTCCTGTGATCTGAGCAAGG - Intergenic
1116012304 14:39366194-39366216 CCACTACTGGGCCCTGAGGACGG - Intronic
1117353376 14:54902137-54902159 CCCCGACTGTGCCCCACGCAGGG + Intronic
1119236471 14:73024283-73024305 CCCTTACTGTGACCTCTGCAAGG - Exonic
1121982724 14:98468749-98468771 GCCTTACTGTGCCTGGAGCATGG + Intergenic
1122104474 14:99441733-99441755 CCCCTGCTGTGGCCTCATCAGGG - Intronic
1122227176 14:100286615-100286637 TCTCTGCTGTGCCCTGATCAAGG + Intergenic
1122305491 14:100763518-100763540 ACCCTACTGTGAACTGCGCATGG - Intergenic
1122307577 14:100775682-100775704 CTCCTGCTGTGCCCACAGCAGGG + Intergenic
1122341874 14:101033861-101033883 CCCCGACGGGACCCTGAGCATGG + Intergenic
1122402835 14:101477369-101477391 CCCCTACTCCGCCCTGGTCAGGG + Intergenic
1122992191 14:105241682-105241704 GCCCCTCTGTGTCCTGAGCAGGG - Intronic
1124810902 15:32937102-32937124 CACTTACTCTGCCCTGAGCAAGG + Intronic
1126142868 15:45451864-45451886 ACCCTACTGTGAACTGTGCATGG + Intergenic
1129377943 15:75145783-75145805 CCCCAACTGTGCCCTTGGCCAGG + Intergenic
1130792406 15:87169551-87169573 CACCTGCTGTGTCCTAAGCAGGG + Intergenic
1132724019 16:1331109-1331131 CCCTCACTGTCCCCGGAGCACGG + Intergenic
1132747133 16:1441504-1441526 CTCCTGCTGTGGCCTCAGCAGGG - Intronic
1132766046 16:1534656-1534678 CCCCTGCTCTGCCCTGAGCGTGG + Intronic
1133498406 16:6342063-6342085 TCCTTACTGTGCCCTGTGCTAGG - Intronic
1135065421 16:19305535-19305557 TCCCTATAGTGCCCTGAGCAAGG - Intronic
1137669176 16:50269441-50269463 CCCCTACCCTGCCCTGTGCCTGG + Intronic
1139819162 16:69706565-69706587 TCCCTACTGTGTTCTCAGCAGGG - Intergenic
1140001060 16:71025476-71025498 CCCCTTCTGTGCCCCGATGATGG + Exonic
1141982939 16:87561096-87561118 CCCCTACTTGGCCCTGCCCAAGG - Intergenic
1142201256 16:88762135-88762157 CCCCCACTGTGCCCTGGGAAGGG + Intronic
1142787927 17:2239008-2239030 CACCTACTGAGCCCTGAGGAGGG - Intronic
1142969980 17:3604755-3604777 CCCCTACCCTGCCCTGAACTGGG + Intergenic
1143466634 17:7141270-7141292 CCCCAACTGTCCCACGAGCAGGG + Intergenic
1143591167 17:7886357-7886379 CCCCTGCTGTTCCCCAAGCAGGG - Intronic
1143640827 17:8196301-8196323 CCCCTACTGTGGCCTATGGAGGG - Intergenic
1144995547 17:19265708-19265730 CCCCTCCTGTGCCCTGGTCCTGG + Intronic
1145060610 17:19731011-19731033 ACCCTGCTGTCCCCTGGGCAGGG + Intergenic
1145230934 17:21172687-21172709 CCCCAGCTGTCCCCTCAGCATGG + Intronic
1145270349 17:21401453-21401475 CCCCTGCTGAGCTCTGAGCTCGG - Intronic
1148049470 17:44762300-44762322 TCCCAACTCTGCCCAGAGCAAGG + Intronic
1148391888 17:47278782-47278804 ACCCTACTGTGAACTGGGCATGG + Intronic
1148700784 17:49585567-49585589 CCACTACTCTGCCCTGTGGATGG - Intergenic
1148855703 17:50578264-50578286 CCCCTACTGTGCCCGGGCCGGGG + Exonic
1149567263 17:57648997-57649019 CCCCTCCTGTGTCCTGCGAAGGG + Intronic
1150301971 17:64054644-64054666 ACCCTGCTGTGCTCTGAGCCTGG + Intronic
1151383511 17:73741478-73741500 TCCCCACTGAGCCCTGAGGACGG + Intergenic
1151426039 17:74031767-74031789 CCCCTCCTGGGCCATCAGCAGGG + Intergenic
1151747363 17:76018649-76018671 CCCCTACTCTGCCCTGGCCTTGG - Intronic
1151869438 17:76826497-76826519 CCCCCACTCTGCGCTGAGGATGG + Intergenic
1151939741 17:77285118-77285140 CCCTTACTGTGGTCAGAGCATGG + Intronic
1152694074 17:81735056-81735078 CCCCTTTTGTGCCCTGAGGGCGG - Intergenic
1157516020 18:48312101-48312123 CCTTTCATGTGCCCTGAGCAGGG - Intronic
1158863546 18:61616283-61616305 ATGCTAATGTGCCCTGAGCAGGG - Intergenic
1159682102 18:71367463-71367485 CTCCTACTTTTCCATGAGCATGG + Intergenic
1159914623 18:74177321-74177343 CCTCTACTGTGCTCTGAGTGTGG + Intergenic
1159937302 18:74379495-74379517 ACCCTACTGTGAACTGTGCATGG - Intergenic
1160398932 18:78594739-78594761 ACCCTACTGTGAACTGTGCATGG - Intergenic
1162344870 19:10113233-10113255 CCCCCACTCTGCCCTGACCTTGG - Intronic
1163703507 19:18798981-18799003 CCCCTGCTGTGCCCTCTGCCTGG - Intergenic
1166318808 19:42003746-42003768 CCCAAACTGTGCCCTCACCACGG + Intronic
1166716143 19:44968998-44969020 TCCCTGCTGAGCCCTGATCAGGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168240273 19:55085730-55085752 CCCCTGCTGTGCCCCCAGCTTGG + Intronic
1168269533 19:55242012-55242034 CCCGTACTGTCCACTGTGCAGGG + Intronic
1202713408 1_KI270714v1_random:29273-29295 CCCTGACCGTGCCCTGAGCATGG - Intergenic
926490328 2:13518072-13518094 CCCTTTCTGTGCCCAGAGTAAGG + Intergenic
926688429 2:15716394-15716416 CCCACACTGTGCCCTGTGCTGGG + Intronic
926735070 2:16067694-16067716 CGCCTACTGTGCGCTGGACAGGG + Intergenic
928372941 2:30754352-30754374 CCACTCCTGAGACCTGAGCATGG + Exonic
930234292 2:48874110-48874132 CCCCTACAGTGCCTTGCTCAGGG - Intergenic
931706134 2:64947925-64947947 CCTCTACTGGGGCCTGAGGAGGG - Intergenic
932007189 2:67938908-67938930 TCCCTACTGCTCCCTGAGCATGG + Intergenic
932451653 2:71814385-71814407 CTCCTCCTTTGCCCTGAACATGG + Intergenic
932947572 2:76254504-76254526 CTCCTACGCTACCCTGAGCAGGG - Intergenic
933412111 2:81939744-81939766 GGCCTCCAGTGCCCTGAGCATGG - Intergenic
933589624 2:84217735-84217757 TCCCTCCTGAGCCCTGAACATGG + Intergenic
936731549 2:115387138-115387160 GCCCTTCTGTGCTCTGAGGAGGG + Intronic
938673260 2:133604901-133604923 CCCCTACTCAGCACTGATCATGG + Intergenic
939628491 2:144507995-144508017 CCCAAACTGTGACCTGACCATGG + Intronic
940050567 2:149458312-149458334 CCTCTACTTTCCCCTGACCAAGG + Intronic
940427408 2:153545874-153545896 CACGTACTTTGCCCTGACCAGGG - Intergenic
941481655 2:166023333-166023355 CCACTACTGTGGCCTGGGCCAGG - Intronic
942116493 2:172734731-172734753 CCCTGACTCTCCCCTGAGCAGGG + Intergenic
944886938 2:204072648-204072670 CCCCTAGGGTGTCCTGATCAGGG + Intergenic
946277777 2:218643901-218643923 CCCCTGCTGTGCCCCGAGTGTGG - Exonic
947027463 2:225752700-225752722 CTCCTATTGTACACTGAGCAGGG - Intergenic
947715326 2:232336288-232336310 CCCCAACTCTGCCCTGACCCAGG + Intronic
948659631 2:239499066-239499088 CCACTGCTGTGCGGTGAGCAGGG - Intergenic
948843508 2:240672090-240672112 GACGTACGGTGCCCTGAGCAGGG + Intergenic
948909993 2:240998228-240998250 CCCCTTCCCAGCCCTGAGCATGG - Intergenic
948930832 2:241130909-241130931 CTGCTTCTGTTCCCTGAGCACGG - Intronic
949010250 2:241674241-241674263 CCCCTGCTGTGCCCCAGGCATGG - Intergenic
1169924100 20:10765330-10765352 ACCCTACTGTGAACTGCGCATGG + Intergenic
1170917956 20:20646485-20646507 CCTCTTCTGTGCCTTGACCATGG + Intronic
1171382168 20:24742259-24742281 CCCCTGCTGTGCCTGGAGGAAGG - Intergenic
1172012896 20:31856765-31856787 CCCCTTCCGTGGCCTCAGCATGG - Intronic
1172232203 20:33344367-33344389 CCCGTGCTGTGCTCTGGGCATGG - Intergenic
1172973335 20:38888979-38889001 GCCCTACTGAGCCCTGGGGAAGG - Intronic
1173075613 20:39816395-39816417 TGCTTACTGTGCACTGAGCATGG - Intergenic
1173791462 20:45830505-45830527 CCCCCACTGTGTCCAGACCAGGG + Intronic
1174070151 20:47893880-47893902 CCCCTGCTGTGCCCCCTGCATGG - Intergenic
1174521011 20:51130808-51130830 CCCATTCGGTGGCCTGAGCAGGG + Intergenic
1176097897 20:63352724-63352746 CCTGCACTGTTCCCTGAGCATGG - Intronic
1176215339 20:63945149-63945171 CAACTACTGTGTGCTGAGCATGG - Intronic
1176262177 20:64187660-64187682 CCCCTACTGGGGCCTGTGTATGG - Intronic
1177324230 21:19563098-19563120 CCTGTGCTCTGCCCTGAGCATGG + Intergenic
1183477471 22:38043358-38043380 GCCCTACTGTGTGCTGAGCCTGG - Intergenic
1184035153 22:41914682-41914704 CCGCTACTGCGCCCGGTGCATGG + Intergenic
1184443904 22:44536009-44536031 CCCCTACTGTGACCATGGCATGG + Intergenic
1184649499 22:45913115-45913137 CCTTTGCTGGGCCCTGAGCAGGG + Intergenic
1184861924 22:47177159-47177181 CCACTGCTGTGCCCTTGGCAAGG + Intergenic
950195441 3:11006074-11006096 CTCCCACTGTGGCCTGTGCAAGG - Intronic
950456000 3:13093128-13093150 CACAGACTGTGCCCTGGGCAGGG - Intergenic
950644793 3:14370744-14370766 CCCTGACTGTGCCCTAAGCCCGG - Intergenic
954217130 3:49130943-49130965 CCCTTACCATGCCCTCAGCATGG + Exonic
954613183 3:51956801-51956823 CACCTGCTGTGACCTGTGCAGGG - Exonic
954636382 3:52073114-52073136 CCCCAGCTCTGCCCTCAGCATGG + Intergenic
955452645 3:59086502-59086524 CTGCTACTGTGGCCTGAGCTGGG - Intergenic
961378448 3:126482201-126482223 CCCTTATGGTGCCCTGTGCAGGG - Exonic
961397515 3:126606289-126606311 CTCCTGCTTTGCACTGAGCATGG - Intronic
962658941 3:137581127-137581149 CCCCTGTTATTCCCTGAGCAAGG + Intergenic
962708957 3:138069780-138069802 CCTCTTCTGTGGCCTGGGCAAGG - Intronic
963398474 3:144764557-144764579 CACCTGCAGTGCCCAGAGCATGG + Intergenic
966549142 3:181184469-181184491 CCCGTACTGACCCCTGATCAAGG - Intergenic
966878149 3:184335283-184335305 CCCCTGCTGTTGCCTGGGCAGGG + Exonic
966904744 3:184513946-184513968 GCCCTACACTGACCTGAGCAGGG + Intronic
968705056 4:2073830-2073852 TCCCTGGTGTGTCCTGAGCAGGG + Intronic
977663446 4:99617272-99617294 CTCCTAATGTGTCCTGAGCATGG + Intronic
984657896 4:182339560-182339582 CCCCCACTGCGTCCTGAGGAGGG - Intronic
985775807 5:1841167-1841189 CCCCTCCTGTCCCCTGAGGAGGG - Intergenic
986335019 5:6748248-6748270 CACAGACTGTGCCCTGTGCATGG + Intronic
987032784 5:13991028-13991050 CACCTACTGTGCTCTGAGAGGGG - Intergenic
995088330 5:108141425-108141447 TCCCTGCTGTTCTCTGAGCAGGG + Intronic
997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG + Intronic
997567964 5:134904411-134904433 CTCCTACTGTGTGCTGAGCCTGG + Intergenic
1000626077 5:163540527-163540549 CCTCTTCTGTGCCCTGTCCAAGG + Intergenic
1001773822 5:174314206-174314228 CCCCTGCTGAGCACTGAGGAGGG - Intergenic
1002133907 5:177096783-177096805 CTCCTCCTCTGCCCTGACCATGG + Intronic
1002416415 5:179123099-179123121 AACCTGCTGTGCCCTGGGCAGGG + Intronic
1002705103 5:181155443-181155465 CCCCTACTGTGGCTTGAGGAAGG + Exonic
1002900315 6:1405305-1405327 CTCCATCTGTGCCTTGAGCATGG + Intergenic
1006298046 6:33178788-33178810 TCCCTACTGCACCCTGAGCTGGG + Intronic
1006921142 6:37627967-37627989 CCCCTCCTGGGCCCTGAGTCTGG + Intergenic
1011839531 6:91479255-91479277 CTCCTACTAGGACCTGAGCACGG + Intergenic
1013659476 6:112280254-112280276 CCCCTTCTGTGCCCTAAAAATGG + Intergenic
1015916817 6:138226076-138226098 CCTCTGCTCTGCCCTGATCATGG + Intronic
1016986720 6:149900881-149900903 CTTCTCCGGTGCCCTGAGCAGGG - Intergenic
1017293782 6:152771262-152771284 CTCTCACTGTGCCCTGAGCTGGG + Intergenic
1018071498 6:160167982-160168004 CCCCTGGTGTCCCCAGAGCAGGG - Intergenic
1018250263 6:161862575-161862597 CCCCTACTGTGACCCCAGCCTGG + Intronic
1018347711 6:162919963-162919985 GACCTACTGTGCTCTGGGCATGG - Intronic
1018914609 6:168125404-168125426 CCCTTTCTCTTCCCTGAGCAGGG + Intergenic
1018984516 6:168625980-168626002 CCCCTATTCTGCAGTGAGCAAGG + Intronic
1019374005 7:679362-679384 CTCCTCGTGTGCCGTGAGCAGGG + Intronic
1019411543 7:908913-908935 CCCCCGCTGTGTCCTGGGCAGGG - Intronic
1019540302 7:1548236-1548258 CCCCCACTGGGCCCTGGGCCAGG - Intronic
1019873465 7:3788958-3788980 TCCCCTCTGTTCCCTGAGCATGG + Intronic
1020184318 7:5947308-5947330 ATCCTACTGTGAGCTGAGCATGG - Intronic
1020268297 7:6576619-6576641 CCCCTGCTGGGCTCTGAGCAGGG + Intergenic
1020298599 7:6777458-6777480 ATCCTACTGTGAGCTGAGCATGG + Intronic
1026799536 7:73390809-73390831 CCCCTACTCTGCTGTGGGCATGG - Intergenic
1026952597 7:74357452-74357474 CTCATGCTGTGCCTTGAGCAGGG - Exonic
1028157138 7:87443312-87443334 CACTTACTGTGCCCTCATCAGGG + Exonic
1028582221 7:92420242-92420264 CCCCAACTGTCCACTTAGCAGGG - Intergenic
1029115691 7:98235955-98235977 ACCCCTCTGTGCCCTGAGCCTGG - Intronic
1029620887 7:101689068-101689090 CCCCAACTGTACCAGGAGCAAGG + Intergenic
1032842746 7:135727151-135727173 CCCCTACTCTGTCCTGACCCCGG + Intronic
1035017838 7:155782136-155782158 CCCCTGCTGTGCCCTGTGATGGG + Intergenic
1035306880 7:157938976-157938998 CCCCTGCAGTGCCTTGTGCATGG + Intronic
1035367380 7:158357900-158357922 CCCCTACTTTGCCCTTGGCTTGG - Intronic
1039454820 8:37699421-37699443 CCTCTACCTTGCTCTGAGCACGG + Exonic
1039794785 8:40903647-40903669 CCCCTAGTTTGCCCTCAGCCTGG + Intergenic
1040972745 8:53154765-53154787 TGTCTACTGTGCCCTGAGCAAGG - Intergenic
1041205572 8:55495189-55495211 CCCCTACTTTGCTCTGAGATTGG + Intronic
1041303142 8:56434075-56434097 ACCCTACTGTGAACTGTGCATGG - Intergenic
1044136698 8:88594635-88594657 ACCCTACTGTGAACTGTGCATGG - Intergenic
1047790775 8:128201349-128201371 GCTCTACTGTGCCTTGGGCATGG - Intergenic
1049385750 8:142342139-142342161 CCCCAACTGTGCCAAGAGGAAGG + Intronic
1052746813 9:32449324-32449346 CCCCTACTGTACCCTGTTCCCGG + Intronic
1053139426 9:35673590-35673612 CCCCTTCTGTGCCTGGAGCTGGG + Intronic
1056179225 9:84065472-84065494 CACCTACTGTGTGCTGGGCATGG - Intergenic
1056815635 9:89798950-89798972 ACCCTACTGTGGCCTGGCCAGGG - Intergenic
1057179557 9:93022399-93022421 CCCCTGCTGACCGCTGAGCATGG - Intronic
1059245761 9:112848508-112848530 CCACTGCTGTGCCATGAGCCAGG + Intronic
1059444205 9:114328121-114328143 CCACTGCTGTGCCCACAGCACGG + Intergenic
1060972579 9:127747219-127747241 CCGCAGCTGTGCCCTCAGCATGG - Exonic
1061512004 9:131067262-131067284 CCCCTTCTGGGCCCTGAGCCAGG - Intronic
1062098987 9:134718260-134718282 CGCCAACTGTGCCGTGGGCAGGG + Intronic
1186398875 X:9238348-9238370 GCCCTACTGTGCTCAGAACAGGG + Intergenic
1187962714 X:24581938-24581960 CCCCAACTGTCCTCTGACCATGG - Intronic
1189191962 X:39117330-39117352 CCCCTAGTATGCCCATAGCAAGG - Intergenic
1192058025 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG + Intergenic
1192432932 X:71124983-71125005 CCCCTACTATGCCCTGTGAGGGG + Exonic
1196464496 X:115958572-115958594 CCCTAACTGTGCCTTTAGCATGG + Intergenic