ID: 997362110

View in Genome Browser
Species Human (GRCh38)
Location 5:133301717-133301739
Sequence CAGCCTGCAAGCTATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997362110_997362113 -1 Left 997362110 5:133301717-133301739 CCAAGGGCATAGCTTGCAGGCTG 0: 1
1: 0
2: 3
3: 13
4: 145
Right 997362113 5:133301739-133301761 GCCCCAGGCGGCTCGCACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997362110 Original CRISPR CAGCCTGCAAGCTATGCCCT TGG (reversed) Intronic
901924070 1:12554832-12554854 CAGCCTGCAAGTCCTGCCCTAGG - Intergenic
902380808 1:16051439-16051461 CAGCCTCTAACCTCTGCCCTGGG + Intronic
902591624 1:17479044-17479066 CAGCCTGAAATCTATGCTCCTGG + Intergenic
903025369 1:20426476-20426498 CAGCCTCCAAGCTCTGCAATGGG - Intergenic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
904003163 1:27349871-27349893 CAGCCTGCCACCTATGACCCGGG + Intronic
905282464 1:36857929-36857951 CAGGCTCCTAGCTATGCCCTGGG - Intronic
905459632 1:38114165-38114187 CAGCCTGGAACCTGGGCCCTTGG + Intergenic
906906947 1:49905315-49905337 CAGCCTGTAGTCTCTGCCCTGGG + Intronic
907097119 1:51791985-51792007 CAGCCTGCAAAGTAAGCCCTAGG + Intronic
907652530 1:56309464-56309486 CAGAATGCAAGCTCTGCCATTGG - Intergenic
908111692 1:60904485-60904507 CAGCCTGCAAACTCAGGCCTGGG + Intronic
912463658 1:109854432-109854454 CAGGTTGCAAGCTGTTCCCTTGG + Intergenic
912954359 1:114144004-114144026 AACCCTGCAAAGTATGCCCTTGG - Intronic
914975839 1:152360786-152360808 CTGCCTACTAGCTATGACCTTGG - Intergenic
915290838 1:154882141-154882163 CAGCCTGGAAGCTATACCACTGG - Intergenic
915470034 1:156120400-156120422 CAGCCTGGAAACTCTGCTCTGGG + Intronic
917451388 1:175150592-175150614 CAGGCTGCAAGCCAGGCACTAGG + Intergenic
917965160 1:180174149-180174171 CAGCCTGCAGGCTCTCCCCTAGG + Intronic
918378519 1:183932696-183932718 CAGCCTGCAGGCTTTGCAGTGGG + Intronic
918917784 1:190667216-190667238 CAGGCAGTAAGCCATGCCCTTGG - Intergenic
919955085 1:202406093-202406115 CAGCCTGAAAGCTATGGCATGGG - Intronic
920926865 1:210349589-210349611 CAGCCTCCCAGCTGTGCCCGTGG - Intronic
921889105 1:220335957-220335979 CAGCCTGAAATCTATGCCTAGGG - Intergenic
922901281 1:229138698-229138720 CACCGTGGAAGCCATGCCCTGGG - Intergenic
1066472913 10:35716701-35716723 CAGACTGGAATCTATGCCATCGG - Intergenic
1070776048 10:79110522-79110544 CAGCCTGCAAGAGGTGCCCTGGG + Intronic
1072205410 10:93199757-93199779 CAGCCTGTAAGCCCTGCACTGGG - Intergenic
1072791408 10:98320948-98320970 CAGGCTCCAGGCTAGGCCCTGGG + Intergenic
1073247441 10:102101578-102101600 CAGCATGAAAGCTAGGACCTTGG - Intergenic
1075345242 10:121677068-121677090 CAGCATGAAAGTTATGGCCTGGG + Intergenic
1075882020 10:125861142-125861164 CTGCCTGCAAGGTTAGCCCTTGG + Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1080036196 11:27714150-27714172 AAGACTGCAAGCCATTCCCTGGG - Intronic
1083628861 11:64085695-64085717 CAGCCTGCAAGGTTGCCCCTGGG - Intronic
1084083897 11:66845955-66845977 CTGCTGGCAGGCTATGCCCTGGG + Exonic
1084434639 11:69131766-69131788 CAGCCAGCAGGCAAAGCCCTCGG - Intergenic
1089731286 11:120520651-120520673 CAGCCAGCCAGCCAGGCCCTTGG - Intronic
1090827345 11:130397116-130397138 CTGCCTGCAAGGTTGGCCCTTGG + Intergenic
1091567130 12:1657136-1657158 CAGGCTGCTGGCTGTGCCCTAGG + Intergenic
1093482154 12:19615285-19615307 CAGCCTGCTATCTATGCAATAGG - Intronic
1103946776 12:124531561-124531583 CAGCCTGGATGCTCAGCCCTGGG - Intronic
1104827023 12:131719186-131719208 CAGACTGCACGGTATTCCCTTGG - Intronic
1108274029 13:48789856-48789878 CTGCCTGCATGCTAAGCGCTCGG + Intergenic
1117825380 14:59696577-59696599 CAGCCTGCCAGCCCTGCCCTTGG - Intronic
1119113359 14:71995983-71996005 CAGTCACCAAGCTGTGCCCTTGG - Intronic
1120385987 14:83846533-83846555 CAGCCTGCATGCCATACCATTGG + Intergenic
1121249749 14:92490614-92490636 CCGCCTGCAAACTGTGCCCTTGG + Intronic
1124021898 15:25933057-25933079 CAGCCTGTGAGCGGTGCCCTGGG - Intergenic
1126841811 15:52724663-52724685 TAGCATGTAAGCTATGCCTTTGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1133087628 16:3377342-3377364 CAGCCTGAAAGCTGTGAACTTGG - Intronic
1136643839 16:31591599-31591621 CATCCTGCCAGCCATGACCTGGG + Intergenic
1136661766 16:31769171-31769193 CATCCTGCCAGCCATGACCTGGG - Intronic
1139940802 16:70604167-70604189 AAGCCTGTAAGCCAGGCCCTGGG + Intronic
1141345852 16:83245037-83245059 CAGCCTGCAAGGTTGGCTCTTGG - Intronic
1141899905 16:86984412-86984434 CTGGCTCCAAGCTGTGCCCTGGG + Intergenic
1142223385 16:88865972-88865994 CAGCCTGCAGGCTCTGCTCAAGG + Intronic
1142742683 17:1940379-1940401 CAGCCTGCGGGCTGTGCACTGGG - Intronic
1142863859 17:2778739-2778761 CAGCCTGCAAGCCTTTCTCTCGG - Intronic
1143656030 17:8294342-8294364 CACTCTGCCACCTATGCCCTTGG + Intronic
1148962456 17:51404929-51404951 TAGCCATCAAGTTATGCCCTGGG + Intergenic
1152589926 17:81206576-81206598 CAGCCTCCTGCCTATGCCCTTGG + Intronic
1155988897 18:32259020-32259042 CATCCTGCACGCTATGCCCTTGG - Intronic
1156617361 18:38803138-38803160 GAGCCTGGAACATATGCCCTGGG + Intergenic
1160452761 18:78977218-78977240 CAGGGTGCGAGCTCTGCCCTTGG - Intergenic
1160700825 19:506557-506579 CACCCAGCAAGCTCTGCCCGGGG + Intergenic
1160869450 19:1270367-1270389 CAGCCTTCCAGTTGTGCCCTGGG - Intronic
1160960784 19:1719873-1719895 CAGCCTCCAAGCCTTGCACTGGG - Intergenic
1161212063 19:3072024-3072046 CAGACCCCAAGCTGTGCCCTGGG - Intergenic
1162339032 19:10080368-10080390 CTGTCTGCAGGTTATGCCCTAGG - Intergenic
1163106140 19:15124079-15124101 CAGCCTGTCAACTAAGCCCTGGG - Intronic
1163124613 19:15238241-15238263 CCTCCTGCATGCTATGCCCGGGG - Exonic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
925386736 2:3467181-3467203 CAGGCTGCAAGGGAAGCCCTCGG + Intronic
925911151 2:8574419-8574441 CAGAGTGAAAGCTAGGCCCTGGG + Intergenic
925931847 2:8714447-8714469 CAGCCAGCAAGCTGGGCCCCAGG + Intergenic
926634599 2:15166114-15166136 GTGCCAGCAAGCTATGCCCTGGG + Intergenic
926813226 2:16774914-16774936 CAGAATGCAAGCCTTGCCCTAGG - Intergenic
932881940 2:75510356-75510378 TAGCCTTTAAGCTATGCCCAAGG - Intronic
935657950 2:105441021-105441043 CAGCCTGCAGGCTCTGCCCTGGG - Intergenic
936046661 2:109193894-109193916 CAGGCTGCAAGCCTTGCCCCAGG + Intronic
937280270 2:120712851-120712873 CAGCATACGAGCTAAGCCCTTGG + Intergenic
937990837 2:127661431-127661453 CAGCCTGCAGGCCTTCCCCTAGG - Intronic
939262919 2:139833367-139833389 CAGCCTCCAGGCTATGCCTCAGG - Intergenic
940337983 2:152548286-152548308 CTGCCTGCAAGGTTGGCCCTTGG + Intronic
948929747 2:241124354-241124376 AGGCCTGCAGGCTATGCCCCAGG - Intronic
1171343898 20:24451470-24451492 CAGGCTGCAGGCTCTGCCATGGG - Intergenic
1174555283 20:51390902-51390924 CAGCCTGTAAGCTGGGCTCTTGG + Exonic
1174765493 20:53249759-53249781 GAGCCTGCAGGATGTGCCCTAGG - Intronic
1176255943 20:64153042-64153064 CACCCTGCATGCTCTGGCCTGGG + Intronic
1177958409 21:27629857-27629879 ACGCCTGCAATCTATGCCCACGG - Intergenic
1178239576 21:30883202-30883224 CAACATGCAAGCCAGGCCCTAGG - Intergenic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1181111839 22:20607004-20607026 CCGCCTGCATGCTGTGTCCTCGG - Intergenic
1181785180 22:25221656-25221678 CAGCATGCCAGCTATGGGCTGGG - Intronic
1183984484 22:41562014-41562036 CAGCCTGCAGGCTCTTCCCAGGG + Intronic
1184099784 22:42336020-42336042 CAGGCTGCAACCTGTGACCTTGG + Intronic
1184361814 22:44023744-44023766 CGGCCTGCAAGCCATTTCCTGGG + Intronic
1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG + Intergenic
950646111 3:14377813-14377835 GTGCCTGCAAGCTAGGTCCTGGG + Intergenic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
954292220 3:49655652-49655674 CATACTGCAAGCCCTGCCCTAGG - Exonic
955076308 3:55616998-55617020 CAGCCTGCAGGCTTTGCCGATGG + Intronic
959648001 3:108724729-108724751 CATCCTGCAATTTATACCCTGGG + Intergenic
961472707 3:127126315-127126337 AAGCCTGCAGACTATGTCCTGGG - Intergenic
961907947 3:130282118-130282140 CAGCCTTCAAGCTATACTCACGG - Intergenic
965741634 3:171881414-171881436 CAGCCTGCTTGCTATTCCCAGGG - Intronic
966599129 3:181757808-181757830 GAGCCTGTAAGCTATGACTTAGG + Intergenic
967098098 3:186193865-186193887 CAGCCTGCTAGCCAGGTCCTGGG - Intronic
967254093 3:187572085-187572107 CAGCCTGATAGGTAGGCCCTAGG - Intergenic
969495117 4:7522134-7522156 CCGCCTGCAAGCTCTGGCCTTGG - Intronic
972400746 4:38701205-38701227 CAGCCCTCAAGCTATGTCCCTGG + Intergenic
974905254 4:68047247-68047269 TAGCCTGCAAGCTAAGGACTAGG + Intergenic
977160219 4:93625242-93625264 GACCCTGAAAGCTATGCCTTTGG - Intronic
983557373 4:169070476-169070498 AAGCCAACAAGCTATTCCCTGGG - Intergenic
986325242 5:6667877-6667899 CAGCCTGCATGCTTTCCCCGGGG + Intronic
990879704 5:60525460-60525482 CAGACTGGAAGTTATGCCATTGG + Intergenic
991551616 5:67843078-67843100 CAGCATGCAAGCTCTTCCTTAGG - Intergenic
994992635 5:107016648-107016670 CAGGCTTCATGCTATGTCCTGGG + Intergenic
995477183 5:112560173-112560195 CTGCCTGCAAACTCTGCCTTAGG + Intergenic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
997234057 5:132262541-132262563 CTTGCTGCAAGCTGTGCCCTAGG - Intronic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
998575378 5:143309761-143309783 CAGCCTCAAAACTATTCCCTAGG - Intronic
1000171606 5:158707967-158707989 CAGCCTGCAAGGTAAGCCCCAGG - Exonic
1006313594 6:33277821-33277843 CGGCCTGCAAGATATCCCCCTGG - Exonic
1018169610 6:161134248-161134270 CAGCCTGCCTGCTAGGGCCTTGG - Exonic
1019200987 6:170315029-170315051 CTGACTGCAAGCCAGGCCCTAGG - Intronic
1019224460 6:170498726-170498748 CAGCCTTACAGCCATGCCCTGGG - Intergenic
1024755694 7:52527911-52527933 CAACCTGCAAGCTCTGCATTGGG - Intergenic
1024931671 7:54670855-54670877 CATCCTGTAATCTATGCACTGGG - Intergenic
1027147206 7:75704014-75704036 CAGCATGGAAGCCCTGCCCTGGG + Intronic
1031874903 7:127128441-127128463 CAGCCTGGCAGCTATCCACTAGG + Intronic
1034312349 7:150099830-150099852 CAGCCTGCCAGCTGTGACCCTGG + Intergenic
1034357829 7:150466974-150466996 CAGCCTCCATGCTCTGCTCTTGG + Exonic
1034794506 7:154000834-154000856 CAGCCTGCCAGCTGTGACCCTGG - Intronic
1039143419 8:34418852-34418874 CAGCCAGCAAGCTATGGCACAGG - Intergenic
1040079609 8:43274233-43274255 GAGCCTTTATGCTATGCCCTGGG + Intergenic
1045366459 8:101480618-101480640 CTACCTGCCAGCTATGCACTGGG + Intergenic
1046962619 8:120126234-120126256 CGGCCTCCAGGCTCTGCCCTAGG - Intronic
1048879605 8:138861455-138861477 CAGCCTGCAATCAGTGCCCTTGG - Intronic
1051480484 9:17554977-17554999 CTGCCTGAAAACTATGACCTTGG + Intergenic
1051728105 9:20109335-20109357 CTGCTTGCAAGCTAAGCCCCTGG + Intergenic
1054713669 9:68536711-68536733 CATCCTGGGAGATATGCCCTCGG - Exonic
1054728323 9:68675169-68675191 GAGTCAGCAAGCTATGGCCTGGG - Intergenic
1055681654 9:78721801-78721823 CAGCCTTTCAGCAATGCCCTTGG - Intergenic
1057190564 9:93084721-93084743 CAGCCCGCAGCATATGCCCTAGG + Exonic
1060543658 9:124448199-124448221 CAGCCTGCAGGCTTTGTCCTTGG + Intergenic
1060661747 9:125408664-125408686 CAGGCTGCGAGCTGTGCCCGTGG + Intergenic
1061723387 9:132567585-132567607 CAGCCCTCAAGCCATTCCCTGGG - Intronic
1186879844 X:13853953-13853975 CAGCTTGCAAGGTTGGCCCTTGG - Intronic
1188107791 X:26164369-26164391 CAGCCTGAGAGTTCTGCCCTGGG - Intergenic
1188111178 X:26197591-26197613 CAGCCTGAGAGTTCTGCCCTGGG - Intergenic
1188442041 X:30222562-30222584 CAGCCTGAAAGCTATGCTTATGG - Intergenic
1188445262 X:30248212-30248234 GAGCCTGCCAGCTCTGGCCTGGG - Intronic
1192030266 X:67503824-67503846 CTGCCTCCAAGCTAAGCCATGGG - Intergenic
1192048613 X:67702464-67702486 CAGGCTGCAAGGTATGATCTGGG - Intronic
1193879977 X:86910232-86910254 CAGCCTCCAAGCTGGACCCTAGG - Intergenic
1197472201 X:126877682-126877704 CAACCAGCAAGCTCTGCCCCAGG - Intergenic
1198276079 X:135097457-135097479 CACCCTGCAAGCTTTGCATTTGG - Intergenic
1202579526 Y:26365063-26365085 CAGCCTGAGAGCTATGGCTTGGG + Intergenic