ID: 997366419

View in Genome Browser
Species Human (GRCh38)
Location 5:133328115-133328137
Sequence GCCTCGTGTGTGTTTAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997366419_997366425 19 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366425 5:133328157-133328179 GTTCCCCGGCTGTGCTGCACTGG No data
997366419_997366420 -3 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366420 5:133328135-133328157 GGCCATGCAGACCTTGCGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
997366419_997366422 5 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366422 5:133328143-133328165 AGACCTTGCGCCTGGTTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997366419 Original CRISPR GCCTCGTGTGTGTTTAACCC TGG (reversed) Intronic