ID: 997366420

View in Genome Browser
Species Human (GRCh38)
Location 5:133328135-133328157
Sequence GGCCATGCAGACCTTGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997366416_997366420 5 Left 997366416 5:133328107-133328129 CCTTTTACCCAGGGTTAAACACA No data
Right 997366420 5:133328135-133328157 GGCCATGCAGACCTTGCGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
997366417_997366420 -2 Left 997366417 5:133328114-133328136 CCCAGGGTTAAACACACACGAGG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 997366420 5:133328135-133328157 GGCCATGCAGACCTTGCGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 100
997366419_997366420 -3 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366420 5:133328135-133328157 GGCCATGCAGACCTTGCGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997366420 Original CRISPR GGCCATGCAGACCTTGCGCC TGG Intronic