ID: 997366422

View in Genome Browser
Species Human (GRCh38)
Location 5:133328143-133328165
Sequence AGACCTTGCGCCTGGTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997366416_997366422 13 Left 997366416 5:133328107-133328129 CCTTTTACCCAGGGTTAAACACA No data
Right 997366422 5:133328143-133328165 AGACCTTGCGCCTGGTTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
997366419_997366422 5 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366422 5:133328143-133328165 AGACCTTGCGCCTGGTTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
997366417_997366422 6 Left 997366417 5:133328114-133328136 CCCAGGGTTAAACACACACGAGG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 997366422 5:133328143-133328165 AGACCTTGCGCCTGGTTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997366422 Original CRISPR AGACCTTGCGCCTGGTTCCC CGG Intronic