ID: 997366425

View in Genome Browser
Species Human (GRCh38)
Location 5:133328157-133328179
Sequence GTTCCCCGGCTGTGCTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997366419_997366425 19 Left 997366419 5:133328115-133328137 CCAGGGTTAAACACACACGAGGC No data
Right 997366425 5:133328157-133328179 GTTCCCCGGCTGTGCTGCACTGG No data
997366416_997366425 27 Left 997366416 5:133328107-133328129 CCTTTTACCCAGGGTTAAACACA No data
Right 997366425 5:133328157-133328179 GTTCCCCGGCTGTGCTGCACTGG No data
997366417_997366425 20 Left 997366417 5:133328114-133328136 CCCAGGGTTAAACACACACGAGG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 997366425 5:133328157-133328179 GTTCCCCGGCTGTGCTGCACTGG No data
997366421_997366425 -3 Left 997366421 5:133328137-133328159 CCATGCAGACCTTGCGCCTGGTT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 997366425 5:133328157-133328179 GTTCCCCGGCTGTGCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997366425 Original CRISPR GTTCCCCGGCTGTGCTGCAC TGG Intronic