ID: 997367829

View in Genome Browser
Species Human (GRCh38)
Location 5:133337043-133337065
Sequence CACCTCTGGCAACTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 0, 2: 0, 3: 26, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997367817_997367829 15 Left 997367817 5:133337005-133337027 CCCTATCACAGCAACACACCCCT 0: 1
1: 0
2: 0
3: 8
4: 155
Right 997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG 0: 2
1: 0
2: 0
3: 26
4: 245
997367825_997367829 -5 Left 997367825 5:133337025-133337047 CCTGTCTCGGGAACGGGACACCT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG 0: 2
1: 0
2: 0
3: 26
4: 245
997367824_997367829 -4 Left 997367824 5:133337024-133337046 CCCTGTCTCGGGAACGGGACACC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG 0: 2
1: 0
2: 0
3: 26
4: 245
997367823_997367829 -3 Left 997367823 5:133337023-133337045 CCCCTGTCTCGGGAACGGGACAC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG 0: 2
1: 0
2: 0
3: 26
4: 245
997367818_997367829 14 Left 997367818 5:133337006-133337028 CCTATCACAGCAACACACCCCTG 0: 1
1: 0
2: 0
3: 21
4: 232
Right 997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG 0: 2
1: 0
2: 0
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997367829 Original CRISPR CACCTCTGGCAACTGGGCAC AGG Intronic
900390719 1:2432719-2432741 CACCTCTGGCATCCGGCCCCAGG - Intronic
900472580 1:2862043-2862065 TGCCTCTGGCATCTGGGCACTGG + Intergenic
900528510 1:3141025-3141047 CACCAATGGCAAGAGGGCACAGG + Intronic
901207714 1:7506279-7506301 CTCCTCTGGGAACCGGGCTCAGG - Intronic
901890736 1:12261564-12261586 CACATGTGGCTACTGAGCACTGG - Intronic
903772691 1:25773961-25773983 AACCTCTGGGCACTGGGCCCGGG + Intronic
904266939 1:29323620-29323642 CCCCTCCTGCAACTGGGGACAGG - Exonic
904458641 1:30662456-30662478 CACTCCTGCCAACTGGGCCCAGG + Intergenic
904638022 1:31899639-31899661 CACCTCTGCCTCCTGGGCTCAGG + Intergenic
905516333 1:38564695-38564717 CACCTCTGGTCACTGTGCCCAGG + Intergenic
907317401 1:53581214-53581236 CACCACTGGGTACTGGGCACTGG + Intronic
908300805 1:62759406-62759428 TACTTCTGCTAACTGGGCACTGG - Intergenic
909009027 1:70311643-70311665 CACCTCTGGGAAGTGGTAACAGG + Intronic
909063149 1:70902380-70902402 CATGTCTGGCAACTGGCCATAGG + Intronic
911110734 1:94181808-94181830 CACATGTGGCTACTGAGCACTGG + Intronic
911497909 1:98653310-98653332 GACCTCTGACTACTGAGCACAGG + Intergenic
912689089 1:111790470-111790492 CAGCTGTGGCAAGTGGGCATTGG - Intronic
915341579 1:155179477-155179499 CTCATCTGGGAACTGGGCACAGG - Intronic
916578360 1:166086798-166086820 CACCTCTGCCAACTGCAGACAGG - Intronic
918223106 1:182454325-182454347 GACCTCTGTCAACAGAGCACTGG - Intronic
919022061 1:192118927-192118949 CACTTCTGCCCACAGGGCACTGG + Intergenic
922989003 1:229889194-229889216 CAGGTCTGGAAACTGGGCAAGGG - Intergenic
922998951 1:229989865-229989887 CACATGTGGCAAATGAGCACTGG + Intergenic
1063956472 10:11272069-11272091 CCCCACTGGGCACTGGGCACTGG - Intronic
1064752483 10:18545155-18545177 CAGCTCTGGCAGCTGGGAAGTGG - Intergenic
1067335832 10:45362707-45362729 CACCTCTGGGGGCAGGGCACAGG + Intergenic
1067571896 10:47377923-47377945 CACTTCAGGCACCTGGGGACAGG + Intronic
1069955517 10:72048644-72048666 CGCCTCTGGCAACCAGGCCCAGG - Intergenic
1070156899 10:73840940-73840962 CACCTCTCGCAGATGGGAACAGG - Intronic
1072371258 10:94768230-94768252 CAGTTCTGCTAACTGGGCACTGG + Intronic
1072607699 10:96998408-96998430 CACCACTGGCAACAGGGCCGGGG - Exonic
1075747446 10:124737558-124737580 CACCTTTGACAACTGGCTACGGG + Intronic
1076549392 10:131267992-131268014 CACTCCTGGCAGCTGGGCCCAGG - Intronic
1076836042 10:133021389-133021411 CCCCGCTGCCGACTGGGCACGGG + Intergenic
1076887326 10:133268684-133268706 TTCCTCTGGCAGCTGAGCACGGG + Intronic
1077065971 11:641054-641076 CACCTCTGAGAACCAGGCACAGG + Intergenic
1077538878 11:3137334-3137356 CAGCTGTGGCAGCTGGGCCCTGG + Intronic
1077891138 11:6418999-6419021 CACCTCCGTCATCTGGGCCCGGG - Exonic
1082556943 11:54574173-54574195 CACCTCTGGAGGCAGGGCACAGG + Intergenic
1083053242 11:59795580-59795602 CACCTCTTGCATCTGGGGAAAGG + Intronic
1083290437 11:61686912-61686934 CACCTCTGTCTCCTGGGGACAGG + Intronic
1083694471 11:64433451-64433473 CACCTCTGATCACTGGACACAGG - Intergenic
1084417595 11:69042409-69042431 CCCCTCAGGCCACTGGACACAGG - Intergenic
1084629849 11:70340903-70340925 CACCACTTGGAACTGGCCACCGG + Intronic
1084630453 11:70345000-70345022 CACCACTTGGAACTGGCCACCGG + Intronic
1085269783 11:75263398-75263420 CACCTCTGGCCAAGGGGCAAGGG + Intergenic
1085663867 11:78395034-78395056 CACACTGGGCAACTGGGCACTGG + Intronic
1085899102 11:80676315-80676337 CATCTCTAGCCACTGGGCTCTGG + Intergenic
1086106826 11:83156579-83156601 CCCCTCTGGGAACTGGGAAGTGG - Intergenic
1088538960 11:110893091-110893113 CATCCCTGGCAACTGAGAACAGG - Intergenic
1088821837 11:113463332-113463354 CATCTGTGGCCATTGGGCACGGG + Intronic
1089607796 11:119651717-119651739 CACCCCAGGCACCTGGGCTCAGG + Intronic
1091463492 12:663824-663846 CACCCGTGGCGACTGGGGACTGG - Intergenic
1093469760 12:19488203-19488225 AACCTCTGGCTCCTGGGCTCAGG + Intronic
1095385253 12:41642873-41642895 CACCTCTGGGGGCAGGGCACAGG - Intergenic
1095696092 12:45145581-45145603 CATATCTGGCAACAGAGCACTGG + Intergenic
1097437791 12:59571937-59571959 TTCCTCTGGCAACTGGTCATAGG + Intergenic
1101822798 12:108196897-108196919 CACATCTGTTAGCTGGGCACAGG - Intronic
1103913710 12:124365376-124365398 CAGCACTGGCAGCTGGGGACTGG - Intronic
1104969874 12:132526491-132526513 CCCCTCTGGCAGCTGGGAGCTGG + Intronic
1107318561 13:39160915-39160937 CACCTTCGGCAAGTGGGCAGAGG - Intergenic
1108058653 13:46510641-46510663 CACCTTTGAAAACTAGGCACTGG - Intergenic
1112146488 13:96705816-96705838 CCCCACTGGCCTCTGGGCACAGG + Intronic
1112428386 13:99326139-99326161 CATTTCTGCCAACTGTGCACAGG + Intronic
1116092449 14:40326751-40326773 CACCTCTGGGGGCAGGGCACAGG + Intergenic
1117537358 14:56714841-56714863 CAAATCTGGCAACTGGGCCTGGG + Intronic
1118291606 14:64529825-64529847 CACCTATGGTAACTGGGGAAGGG - Intronic
1121967847 14:98326871-98326893 CACCACTGGGAACTGGGTAAGGG + Intergenic
1123991137 15:25684185-25684207 CACCTCTGGCCCCTGCTCACTGG + Intronic
1126667117 15:51085474-51085496 GACCTGTGGCAAATGGGCCCAGG + Intronic
1126795918 15:52260339-52260361 CACCTCTGGCCGCTGGGCTTGGG + Intronic
1127087258 15:55436146-55436168 CACCTCTACCAACAGTGCACAGG + Intronic
1127312427 15:57764628-57764650 CACATGTGGCTACTGGGCACTGG - Intronic
1128077165 15:64834733-64834755 CACATGTGGCAATTGAGCACTGG - Intergenic
1128582203 15:68818289-68818311 CACCTCTCCCAACTGGGCTCCGG - Intronic
1130545893 15:84857542-84857564 CACATCTGGTACCTGGGCGCAGG - Exonic
1131440817 15:92458378-92458400 CATCTCTGGTAACTGGGCTGGGG - Intronic
1134189256 16:12108643-12108665 CAGCTGTGGCATCGGGGCACAGG - Intronic
1134689570 16:16182454-16182476 CACATCTGGCTGCAGGGCACAGG + Exonic
1135256338 16:20944481-20944503 CCCCTCAGGTAACTGGGCTCGGG - Exonic
1135935602 16:26777258-26777280 CCCCTCTAGTAACTGAGCACTGG - Intergenic
1136403179 16:30029390-30029412 AACCACTGGCACCTGGGCAGGGG + Intronic
1137436155 16:48455685-48455707 CACCTCTGCCAACTGGGAGCTGG - Intergenic
1138094276 16:54199943-54199965 CTGCTCTGTCAGCTGGGCACAGG - Intergenic
1140977999 16:80079409-80079431 GAGCTCTGGCAACTGGGCTGTGG - Intergenic
1141281297 16:82631927-82631949 CAACTCTGGCTTCTGGGCAGAGG + Intronic
1141293120 16:82739063-82739085 CACCCCTGGGAACTGTGCCCTGG + Intronic
1141448161 16:84077141-84077163 AACCTCTGCCATCTGGGCTCAGG - Intronic
1143501466 17:7341945-7341967 CAGCTCCTGAAACTGGGCACTGG + Exonic
1143501902 17:7344038-7344060 CAGCTGGTGCAACTGGGCACAGG - Exonic
1143850800 17:9810399-9810421 CACCACTGGCTATAGGGCACAGG + Intronic
1146937134 17:36818916-36818938 CAGCCCTGGCACCTGGGCACTGG + Intergenic
1147315234 17:39617223-39617245 GCCCTCTGGCAACTGGCCTCTGG + Intergenic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148908203 17:50925008-50925030 CACCCCAGGCACTTGGGCACTGG + Intergenic
1151674894 17:75592324-75592346 CTACTCTGGGAACTGGGCAGGGG - Intergenic
1152278380 17:79371345-79371367 CTCCTCTGGAATCTGGCCACGGG - Intronic
1152791648 17:82283352-82283374 GACCTCTGGGAGCTGGGGACAGG - Intergenic
1153480500 18:5543129-5543151 CGCCTCTGGCACCCGGGCGCGGG - Intronic
1153590800 18:6672476-6672498 CAGCTCTGGAAACTGGGCAAGGG + Intergenic
1154194337 18:12254650-12254672 ACCCTCTTGCAGCTGGGCACAGG + Intronic
1157039712 18:44024257-44024279 CACCTCTGGGGGCAGGGCACAGG - Intergenic
1157327864 18:46681898-46681920 CACATGCGGCTACTGGGCACTGG - Intronic
1157625029 18:49044305-49044327 CACCCCTGCCAACTGGTCACAGG + Intronic
1161008985 19:1950957-1950979 CTCCCCTGAAAACTGGGCACGGG - Intronic
1163203789 19:15787595-15787617 CACCTCTGGGAACGTGCCACTGG + Intergenic
1163291761 19:16383869-16383891 CACCTGGGGCACCTGGGCATGGG + Intronic
1163815969 19:19464782-19464804 CACCTCTGGGGAGTGGGGACTGG - Intronic
1164157226 19:22604025-22604047 CACCTCTGGCCACTAGGAGCAGG - Intergenic
1165972907 19:39648271-39648293 AACCTCTGGCTTCTGGGCTCAGG - Intergenic
1165978865 19:39702633-39702655 AACCTCTGGCTCCTGGGCTCAGG - Intergenic
1166666260 19:44682384-44682406 CTCCTCTGACAAATGGGCACTGG - Intronic
1167045140 19:47045360-47045382 CACCTCTGTCATCCGGGCAGGGG + Exonic
925459384 2:4047094-4047116 CAGTTCTAGGAACTGGGCACAGG + Intergenic
926928974 2:18017456-18017478 CACCTCTGGGGGCAGGGCACAGG - Intronic
927096422 2:19750828-19750850 CACCTGTGGCAGCTGAGCCCTGG + Intergenic
927508998 2:23632602-23632624 CACCTCTGACCACCGGGCCCTGG - Intronic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
931267538 2:60673797-60673819 CACGTGTGGCCACTGAGCACTGG + Intergenic
931776927 2:65548920-65548942 CACCTCTGGTAACTGGGACTGGG + Intergenic
932713485 2:74084851-74084873 CACCTCTGCCTCCTGGGCTCAGG - Intronic
934716305 2:96546637-96546659 CTCCTCTGGCCCCTGGCCACGGG - Intronic
934950281 2:98571224-98571246 CAGCCCTGGGAAATGGGCACCGG + Intronic
935139554 2:100340558-100340580 CATCGCTGGCCACTGGGCATAGG - Intergenic
936152820 2:110030953-110030975 CACTTCTGTCCAGTGGGCACAGG - Intergenic
936191860 2:110340459-110340481 CACTTCTGTCCAGTGGGCACAGG + Intergenic
937837894 2:126492501-126492523 CACCTTGGGCACCTGGTCACAGG - Intergenic
938537565 2:132257999-132258021 CCCCTCTGGCGGCTGCGCACGGG - Intergenic
940294840 2:152111716-152111738 AACATCTGGCAAATGGGCAAAGG - Intergenic
940639131 2:156329609-156329631 CGCATCTGGCAACTAGACACCGG + Exonic
941632765 2:167902987-167903009 CACCTCTGCCTCCTGGGCCCAGG - Intergenic
941864233 2:170317364-170317386 AACCTCTGGGAACAGGGCCCAGG - Intronic
944108587 2:196106768-196106790 CACCTCTGGCAAGAAGGCACAGG + Intergenic
948349665 2:237328325-237328347 CACCTGTGGCTTCTGGGAACAGG - Intronic
1169673671 20:8132014-8132036 CACCTCTGCAACCAGGGCACGGG + Intergenic
1170940754 20:20846095-20846117 CCACTCTGGGCACTGGGCACTGG + Intergenic
1172094811 20:32455492-32455514 CACCTCTGGCCCCCGGGCCCAGG + Intronic
1172200035 20:33119123-33119145 CCCCTCTGGGTACTGGGTACTGG + Intergenic
1172595619 20:36149244-36149266 CACCTCTGGCAAAGGGGCTGGGG - Intronic
1173052186 20:39574184-39574206 GGACTCTTGCAACTGGGCACAGG + Intergenic
1175217788 20:57400590-57400612 CAACGCTGGACACTGGGCACAGG - Intronic
1175422190 20:58841469-58841491 CAGCTCTGGGACCTGGGCTCCGG - Intronic
1175517483 20:59578294-59578316 CACCCATGGCCACTGAGCACAGG - Intronic
1175856049 20:62121844-62121866 CCCCGCCGGCACCTGGGCACTGG + Intergenic
1176085644 20:63294332-63294354 CACCTCTGGGCACTGGTCACTGG + Intronic
1177925023 21:27203367-27203389 CCCATCTGGCATCTGGCCACTGG - Intergenic
1178817754 21:35946848-35946870 CACCTCTGCCAATTAGGCAAAGG - Intronic
1179296337 21:40066077-40066099 CACCCCTGCCTACTGGGCATGGG - Intronic
1180001524 21:44997486-44997508 CAGCTCTGGGAGCTGGGCCCCGG + Intergenic
1180020057 21:45117833-45117855 TACCTCTGGAAACGGGGCATGGG - Intronic
1180179490 21:46111643-46111665 GACCCCTGGCACCTGGGTACTGG - Intronic
1180179516 21:46111705-46111727 GACCCCTGGCACCTGGGTACTGG - Intronic
1180179542 21:46111767-46111789 GACCCCTGGCACCTGGGTACTGG - Intronic
1180179568 21:46111829-46111851 AACCCCTGGCACCTGGGTACTGG - Intronic
1181106575 22:20579298-20579320 CACCACTGACACCTGGGCACAGG + Intronic
1181106725 22:20580021-20580043 CACCACTGACACCTGGGCACAGG + Intronic
1181282656 22:21730848-21730870 CACCTGGGGCCACTGGGCAATGG - Intronic
1183191380 22:36323905-36323927 CACCAGTGGTAACTGGACACCGG + Intronic
1183354881 22:37352877-37352899 TACTTCTGGCTGCTGGGCACAGG + Intergenic
1184426550 22:44412199-44412221 CTCCTCTGACCTCTGGGCACTGG + Intergenic
1184473087 22:44706984-44707006 CATCTCTGCCACCTTGGCACTGG - Intronic
1184839468 22:47044037-47044059 CAGCCCAGGCAGCTGGGCACTGG + Intronic
1184876177 22:47277146-47277168 CCCCTCTGGCACCTGGACCCCGG - Intergenic
1184878636 22:47291221-47291243 CACCTCTGCCTGCTGGGCAGCGG - Intergenic
1185113848 22:48920102-48920124 CCTCTCTGGCCACGGGGCACTGG + Intergenic
949486266 3:4542385-4542407 CATCTCTGGCAACTGGCAAAAGG - Intronic
950012756 3:9734655-9734677 CACCTCTGGCAGCTTGGGAGTGG - Exonic
950465840 3:13153214-13153236 CTCCTCTGGCTGCTGGGCACAGG - Intergenic
952043262 3:29285509-29285531 CATCATTGGCAACTGGGCACTGG - Intronic
954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG + Intronic
955808676 3:62763111-62763133 CATCTCTGGCACCTGAGTACAGG - Intronic
957948800 3:87097822-87097844 CACCTCTGGGAGCAGGGCATAGG - Intergenic
959835781 3:110916896-110916918 CACCTCTGGGGGCAGGGCACAGG - Intergenic
960274220 3:115708766-115708788 CACCTCTGGCAGCTGGGGGATGG + Intronic
960539565 3:118848442-118848464 CAATTCTGCCAACTGTGCACTGG - Intergenic
960582163 3:119289947-119289969 CAGCTCTCCCAACTGGGCTCAGG + Intergenic
962343501 3:134603833-134603855 GAGCTTTGGCAACTGGGGACAGG - Exonic
962753576 3:138451856-138451878 CAGCCCTGGCAACTCGGAACTGG - Intronic
965468422 3:169060846-169060868 CAGATCTGGAAACTGGGCAAGGG + Intergenic
966767619 3:183477697-183477719 CTCCTCTTGCCACTGGGCAATGG + Intergenic
968663492 4:1808770-1808792 CACCTCTGGCCACCATGCACTGG - Exonic
968714076 4:2141590-2141612 GTCCTCTGCCAACTGGGCCCTGG + Intronic
969964489 4:10979912-10979934 CACCTCTAGTAAGTGGGAACTGG + Intergenic
970983708 4:22130705-22130727 CACCTCAGGCAAAGTGGCACAGG - Intergenic
973057741 4:45681211-45681233 CACATCTGAAAACTGGGCAAGGG - Intergenic
974182440 4:58401346-58401368 CACCTCTGGGGGCAGGGCACAGG - Intergenic
975669786 4:76769596-76769618 CAGCTCTGGTAACTGGAGACAGG + Intronic
975802935 4:78081297-78081319 CACATGTGGCTACTGAGCACTGG + Intronic
975805361 4:78106281-78106303 CACCTCTGGGGGCAGGGCACAGG + Intronic
977234863 4:94495866-94495888 CCCCTCTGGCAACTGGTCCATGG - Intronic
977957120 4:103041518-103041540 TACCTCCTGCAAGTGGGCACTGG - Intronic
978833656 4:113119988-113120010 CACCACTGGCAACTTGGTAGAGG - Intronic
980102906 4:128559510-128559532 CCACTCTGGCAACTGAGCAGAGG - Intergenic
981979329 4:150772295-150772317 CTCCTCTGGCAACTGATCACAGG + Intronic
983173199 4:164558955-164558977 CACCTCTGGGGGCAGGGCACAGG - Intergenic
984250703 4:177330885-177330907 CACATGTGGCAAGTGAGCACTGG - Intronic
984884796 4:184440662-184440684 CACCTGTGGAAAATGGGAACAGG - Intronic
986499400 5:8383271-8383293 CAACCCTGTGAACTGGGCACTGG - Intergenic
988807660 5:34755482-34755504 CACTTGTGGCTACTGAGCACTGG - Intronic
989617838 5:43355294-43355316 AACCTCTGGCTCCTGGGCTCAGG - Intergenic
990292101 5:54362734-54362756 AACCTCTGGCAAAAGGGCATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991555462 5:67890152-67890174 CACCTCTGGGGGCAGGGCACAGG + Intergenic
992049752 5:72931439-72931461 TAGTTCTGGTAACTGGGCACTGG - Intergenic
994307693 5:98227040-98227062 CACCTCTTTAAACTGGGCTCAGG - Intergenic
997283286 5:132661819-132661841 CACCTCTGTGAACAGGGCTCTGG + Intergenic
997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG + Intronic
997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG + Intronic
999998994 5:157119924-157119946 CACCTCTCCTAACTGGGCTCAGG - Intronic
1000148767 5:158479621-158479643 CACCTCTGACCATTGGTCACCGG - Intergenic
1001488898 5:172141681-172141703 CACCTCTGACAAGAGGGCCCAGG - Intronic
1001900035 5:175419609-175419631 CAGCTCTGGCCACAGGGGACAGG + Intergenic
1002448397 5:179304051-179304073 CACGTCTGGGACCTGGGCATTGG - Intronic
1202775136 5_GL000208v1_random:62904-62926 CACCTCTGGGGGCAGGGCACAGG - Intergenic
1005907445 6:30276605-30276627 CAGGTCTGGAAACTGGGCAAGGG - Intergenic
1007605943 6:43118170-43118192 CACCTATGGCCCCTGAGCACTGG + Intronic
1007706719 6:43795597-43795619 CACCACTGGCATCTGGGGGCCGG - Intergenic
1012310895 6:97722770-97722792 CCCCTCTGTCACCTGGTCACAGG - Intergenic
1013368181 6:109450063-109450085 CCCTTCTGGCCCCTGGGCACTGG - Exonic
1013491924 6:110655842-110655864 CAGCTCAGGAAACTGGACACAGG + Intronic
1014370648 6:120603135-120603157 CACTACTGGCAACTGAGTACTGG - Intergenic
1014787495 6:125635160-125635182 CTCCTCTACCAACTGGCCACAGG + Intergenic
1014871715 6:126604025-126604047 CTCCTCTGTCTACTGGGCTCTGG + Intergenic
1015283691 6:131460818-131460840 CAGCTCTCACATCTGGGCACGGG + Intergenic
1017726655 6:157281024-157281046 GACCTCTGGCCGCTGAGCACAGG - Intergenic
1018179093 6:161205019-161205041 CACCACTGGGGACTGGGCAAAGG + Intronic
1018492415 6:164307633-164307655 CACCACTGCCATCTGGGCCCAGG - Intergenic
1019040258 6:169098051-169098073 CACCTCTGATCACTGGGCTCTGG + Intergenic
1020640459 7:10747616-10747638 CACCTCTGGCGGCAGGGCATAGG + Intergenic
1022009080 7:26292941-26292963 CACCTCTGGGGCCTGGGAACTGG + Intronic
1029151774 7:98485335-98485357 CACCTGTGGCCACTAAGCACTGG - Intergenic
1032069438 7:128794718-128794740 CACCTCTGCCTGCTGGGCGCTGG - Exonic
1032161468 7:129514135-129514157 CTCCTCTGGCAACTGGCCAAGGG - Intergenic
1032755638 7:134888365-134888387 CAGTTCTGGCAGCTGGACACTGG + Intronic
1039751016 8:40478838-40478860 GGGCTCTGGCAAGTGGGCACAGG - Intergenic
1040649304 8:49431298-49431320 CAGTTCTGCTAACTGGGCACTGG - Intergenic
1042316296 8:67429893-67429915 CACCTCTGCCACTTGGGTACTGG + Intronic
1044986925 8:97764051-97764073 AACCTCTGCCTACTGGGCTCAGG - Intergenic
1045143512 8:99313746-99313768 CACCTCTGGGGACAGGGCATAGG - Intronic
1045359984 8:101424188-101424210 GACCTCTGGCAACTGGACTAAGG - Intergenic
1046007669 8:108505875-108505897 CACCTCTGGGGGCAGGGCACAGG - Intergenic
1046058270 8:109104828-109104850 CACATTTGGTAACTGGGCACCGG + Intronic
1049594087 8:143475545-143475567 CCCCGCTGGCAACTGGACGCAGG + Exonic
1050149824 9:2608285-2608307 AAACTCTGACAAGTGGGCACTGG - Intergenic
1050384518 9:5073058-5073080 GAGCTCTGGCAACTGGCCACGGG - Intronic
1057039445 9:91836810-91836832 CACCTCTGCCGCCTGGGCAGTGG + Intronic
1058976432 9:110129061-110129083 TACCTCTGGCAAGTGGCCAGAGG + Intronic
1060474363 9:123975844-123975866 CAGCTCTGGGCACTGGGCACTGG + Intergenic
1061186650 9:129058968-129058990 CACTTCTGGCAGCTGAGCACTGG - Intronic
1061232911 9:129325303-129325325 GAGTTCTGGCAGCTGGGCACTGG + Intergenic
1062512921 9:136917346-136917368 CACCCCAGGCACTTGGGCACTGG + Intronic
1062699862 9:137893155-137893177 CACTTCTAGCAGCTGTGCACCGG - Intronic
1186863694 X:13698025-13698047 CACATGTGGCTACTGAGCACTGG - Intronic
1189430070 X:40938415-40938437 CTCCTCTGACATCTGGGCAGAGG + Intergenic
1190072624 X:47291573-47291595 CAACTCTGGACACTGGGCAAAGG - Intergenic
1190559086 X:51669794-51669816 CCCCTGTGTCAACAGGGCACCGG + Intergenic
1190565205 X:51723528-51723550 CCCCTGTGTCAACAGGGCACCGG - Intergenic
1191567275 X:62555985-62556007 CACCTCTGGGGGCAGGGCACAGG + Intergenic
1191674740 X:63783221-63783243 CATTTCTGGCAACTGGGAACTGG - Intronic
1192153700 X:68727507-68727529 CCACTCTGGCAACAGGGCACTGG - Intergenic
1192299091 X:69881518-69881540 CAACTATGGCAACTGGGCTAAGG - Intronic
1192535678 X:71925233-71925255 CACCACTGTCAATTTGGCACTGG - Intergenic
1196010073 X:110877397-110877419 CACCTCTGGAAAATAGGCACAGG + Intergenic
1197200756 X:123746627-123746649 GTCCTCTGGTAAATGGGCACAGG + Intergenic
1197676689 X:129337588-129337610 CACCTCTGGGGGCAGGGCACAGG + Intergenic
1197975390 X:132161592-132161614 CACCTCTGGGGGCAGGGCACAGG - Intergenic
1198497899 X:137212239-137212261 CACAGCTGGCAACTTGACACTGG + Intergenic
1199744528 X:150763504-150763526 GGCCTCTGGCAGCTGTGCACAGG + Intronic
1200134616 X:153868838-153868860 CACCACTGAACACTGGGCACAGG + Exonic
1200706683 Y:6449015-6449037 TAGCTCTGACAAATGGGCACCGG - Intergenic
1200920983 Y:8612700-8612722 CAGCTCTGACAATTGGGCGCTGG + Intergenic
1200930378 Y:8691584-8691606 CAGCTCTGACAGTTGGGCACTGG - Intergenic
1201027429 Y:9715693-9715715 TAGCTCTGACAAATGGGCACCGG + Intergenic