ID: 997368135

View in Genome Browser
Species Human (GRCh38)
Location 5:133338873-133338895
Sequence TGGTAGGAGTGGTGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997368135_997368140 -5 Left 997368135 5:133338873-133338895 CCAGTTTCCCACCACTCCTACCA 0: 1
1: 0
2: 2
3: 51
4: 369
Right 997368140 5:133338891-133338913 TACCACCTCTGCTGTAGTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 104
997368135_997368143 14 Left 997368135 5:133338873-133338895 CCAGTTTCCCACCACTCCTACCA 0: 1
1: 0
2: 2
3: 51
4: 369
Right 997368143 5:133338910-133338932 CAGGAAGCCATTAACACCCCCGG 0: 1
1: 0
2: 3
3: 28
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997368135 Original CRISPR TGGTAGGAGTGGTGGGAAAC TGG (reversed) Intronic
900232229 1:1565606-1565628 TCGTGGGGGTGTTGGGAAACTGG - Intronic
900726594 1:4220348-4220370 TGGGAGGAGTGAGGGGATACAGG + Intergenic
900797163 1:4715079-4715101 TGGAAGGAGTGCTGGGACAGAGG + Intronic
900985347 1:6069925-6069947 TGGTCTGAGTGTTGGGAAATGGG - Intronic
901625731 1:10623885-10623907 GGGAAGGAGCAGTGGGAAACAGG + Intronic
901863472 1:12089205-12089227 TGGAAGGAGTGTTAGGAAAGTGG - Intronic
902586148 1:17439546-17439568 TGGTTGGAGTGATGAGAAACCGG + Exonic
902830699 1:19010495-19010517 TGGAAGGAGAGGAGGGAAATGGG + Intergenic
903461436 1:23523771-23523793 TGGTAGAAGTAGTGCGAGACTGG + Intronic
903878533 1:26492790-26492812 TGGGGGGTGTGGTGGGAGACAGG + Intergenic
903938728 1:26914094-26914116 TGGCAGGAATGGTGGGGAAGTGG + Intronic
904875756 1:33653363-33653385 TGTCAGGAGGAGTGGGAAACAGG + Intronic
904991819 1:34599168-34599190 AGGCAGGAGTGGTGGGAGGCAGG - Intergenic
905145167 1:35882818-35882840 TGGGAGGAGAGGTGGGAGGCAGG + Intronic
905460603 1:38120462-38120484 TGGAAGGAGTGGTTGGACTCTGG - Intergenic
905676977 1:39833434-39833456 TGGTAGGAGGGGAGGGCACCTGG - Intergenic
906582394 1:46946891-46946913 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
906583165 1:46953062-46953084 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
906601206 1:47130986-47131008 TGGTAAGGGTTGTGGGGAACGGG + Intergenic
906655631 1:47546362-47546384 TGCTAGGAGCGGTGGGAACAGGG - Intergenic
906671145 1:47655840-47655862 TTCGAGGAGTGGTGGGAAAGAGG - Intergenic
907129085 1:52079094-52079116 TGGTAGGAGAGGTGTCTAACTGG + Intronic
907505907 1:54918121-54918143 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
907541920 1:55223280-55223302 TGGAAGGAGCGGTGGGAACAGGG + Intergenic
907602790 1:55787508-55787530 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
907826269 1:58020046-58020068 TGGTAGTAGTTGAGGGAAATAGG - Intronic
909517075 1:76522991-76523013 TGGTAGAAGTAGTGAGAAACTGG + Intronic
909587140 1:77302598-77302620 TGGTGGTAGTGGTGGGTAAATGG + Intronic
909708151 1:78611670-78611692 GAGTAGGAGTGGTGAGAAAAGGG - Intergenic
910590658 1:88925581-88925603 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
912412682 1:109489268-109489290 TGGTATGCCTGGTTGGAAACAGG - Intronic
912951656 1:114124477-114124499 TGATGGGAGTGGTGGGGAGCTGG + Intronic
913217331 1:116631434-116631456 TGGCAGAAGTGATGGGAAAGGGG + Intronic
916680942 1:167104487-167104509 TGGTGGGTGTGGTAGGAGACAGG + Intronic
918482419 1:184992785-184992807 GGGAAGGTCTGGTGGGAAACAGG + Intergenic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
924483948 1:244461643-244461665 GGGTGGGAGCGGTGGGACACTGG - Intronic
924552335 1:245090206-245090228 AGGTAGGAGGAGTGGGTAACAGG + Intronic
924826030 1:247539941-247539963 TGGGAGAAGTGGTGGGAAGTGGG - Intronic
1064419208 10:15175976-15175998 TGGGAGGAGTGGGGGGAAAGAGG + Intergenic
1065579153 10:27154315-27154337 TGGGAGGAGTGAGGGGCAACGGG - Exonic
1065966278 10:30773174-30773196 TGTGAGGAATGGTGGGAATCCGG - Intergenic
1066191805 10:33062802-33062824 TGGGAAGTGTGGTGGGGAACTGG + Intergenic
1067761379 10:49049812-49049834 TGGTAGGGGTGCAGGGAATCTGG + Intronic
1068572748 10:58649104-58649126 TGATAAAAGTGGTGGGAAATGGG + Intronic
1068800816 10:61137921-61137943 GGGTAGGAGTGGTTAGAAAGAGG - Intergenic
1070258077 10:74827113-74827135 TGGTAGGAGCGGTGGGGGGCCGG + Intronic
1071327240 10:84529630-84529652 TGGCAAGGGTGGTGGGGAACAGG + Intergenic
1072108874 10:92299050-92299072 AGGTAGGATTGGTGGAGAACAGG - Intronic
1072175802 10:92920515-92920537 TGGTTGGAGGGGTGGGTAATGGG - Intronic
1072226948 10:93379335-93379357 AGGTAGGAGTGGGGTGGAACAGG - Intronic
1074111261 10:110424171-110424193 TGGGAGGAGTGGTGGGTTAGTGG + Intergenic
1074462955 10:113655178-113655200 TGGTTAGAATGTTGGGAAACAGG + Intronic
1074610507 10:115016829-115016851 TGGAGGGGGTGGTGGGAAGCTGG + Intergenic
1075292783 10:121244562-121244584 TGGTGGTGGTGGTGGGAAATGGG - Intergenic
1076257197 10:129037048-129037070 TGGCAGTAGTGGTGGGAAGTAGG + Intergenic
1077598747 11:3557607-3557629 TGGTGGTCGTGGTGGGAAACTGG - Intergenic
1078509258 11:11973524-11973546 AGGGAGGAGTGGGGGCAAACAGG - Intronic
1079277581 11:19056256-19056278 TGGTCGGGCTGGTAGGAAACGGG - Exonic
1079882425 11:25944200-25944222 AGGCAGGAGTGGTGACAAACAGG - Intergenic
1079934064 11:26596463-26596485 TGGCAAGGGTGGTGGGGAACGGG + Intronic
1080732533 11:34974172-34974194 TGTCAGGGGTGGTGGGAAAGAGG - Intronic
1081402763 11:42661920-42661942 TGGTGGGAGTGTTGGGACCCAGG - Intergenic
1081611594 11:44566249-44566271 TGTTAGAATTGGTGGGAAGCAGG - Intronic
1082677052 11:56117953-56117975 TGGGAGGAGTGTTCAGAAACAGG - Intergenic
1082883188 11:58058376-58058398 TGGGAGGAGTGCAGGGATACAGG - Intronic
1083484307 11:62973830-62973852 GGCTTGGAGTGGTGTGAAACTGG + Intronic
1084254819 11:67933479-67933501 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1084456738 11:69272157-69272179 TTGAAGGAGTGATGGGTAACTGG - Intergenic
1084818055 11:71662408-71662430 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
1084918681 11:72451099-72451121 GGGAGGGAGTGGTGGGAGACGGG + Intergenic
1084955565 11:72689484-72689506 TGGGAGCAATGGTGGGGAACAGG - Intronic
1085027129 11:73242808-73242830 TGGCAGCAGTGGCAGGAAACGGG + Intergenic
1085544475 11:77304233-77304255 TGATAAGAGAGGAGGGAAACAGG - Intergenic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1085993525 11:81881593-81881615 TTGGAAGAATGGTGGGAAACAGG - Intergenic
1086137964 11:83461768-83461790 GGGTAGGGCTGGTGGGAACCTGG + Intronic
1086480930 11:87237807-87237829 TGGTAAGAGTAGTGGGGAGCAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092007927 12:5085339-5085361 TGGTGTGTGTGGTGGGACACAGG - Intergenic
1092291190 12:7160282-7160304 TGGGAGGAGAGGTGGGAGGCAGG - Intergenic
1092361372 12:7839397-7839419 TGGCAGGAGTGGAGTGAAGCGGG + Intronic
1092375815 12:7954661-7954683 TGGCAGGAGTGGAGTGAAGCGGG + Intergenic
1092424882 12:8366948-8366970 TGGTGGTGGTGGTGGGAAGCTGG - Intergenic
1092469761 12:8767286-8767308 TGGCAAGGGTGGTGGGGAACAGG + Intronic
1092694830 12:11159620-11159642 TCTTAGGAATGCTGGGAAACGGG - Intronic
1094183870 12:27620285-27620307 TGGTGGGAGTGGTGGGGTAGTGG - Intronic
1095283634 12:40385062-40385084 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
1096794011 12:54062669-54062691 GGGTATGAGTGGGGGGAAAGAGG - Intergenic
1097393231 12:59041061-59041083 TTGTAGGAGGTGAGGGAAACTGG - Intergenic
1097684974 12:62682825-62682847 GGGGAGGGGTGGTGGGAAACAGG + Intronic
1097922987 12:65096860-65096882 TGTTAGGAGTGGAGGGCAAGGGG + Intronic
1098894982 12:76048858-76048880 TTGTAGGAGTGTTCGGGAACTGG - Intronic
1098925199 12:76341884-76341906 CGGTGGCAGTGGTGAGAAACGGG + Intergenic
1100435733 12:94569880-94569902 TGGCGGGAGTGGTGGGACAAGGG + Exonic
1101740494 12:107496248-107496270 TGGTGGGAGTGCTGGGAGACAGG - Intronic
1102091517 12:110193155-110193177 TGGGGGGAGGGGTGGGAGACAGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102835039 12:116048416-116048438 TGGCAGGAGTGGTAAGATACAGG + Intronic
1104348613 12:128025324-128025346 TGATAGGAGTGATGGAAAAGAGG + Intergenic
1104732524 12:131115756-131115778 TGACAGCAGTGGTGGGAAAGGGG + Intronic
1107531632 13:41287989-41288011 TGATGGGAGTGTTGGGAAAATGG + Intergenic
1108442107 13:50465213-50465235 TGGTGGGAGTGGGGTGAACCGGG + Intronic
1108981498 13:56521411-56521433 TGGCTGGATCGGTGGGAAACAGG - Intergenic
1109591677 13:64491885-64491907 TGGTAGGAGTGATTGGATAATGG - Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1110619676 13:77581492-77581514 AGGGAGGAGAGGTGGGAATCTGG - Intronic
1113149967 13:107252338-107252360 TGGGACAGGTGGTGGGAAACAGG + Intronic
1114738788 14:25071842-25071864 TGGTAGTAGTGGTGGGCAATGGG - Intergenic
1115871645 14:37810693-37810715 TGGCAGGAATGCTGAGAAACAGG - Intronic
1115879272 14:37896614-37896636 GGGAAGCAGTGGTGGGAAACGGG + Intronic
1117803735 14:59469190-59469212 TGCTAGGACTGCTGGGAAACTGG - Intronic
1118090790 14:62474996-62475018 GGGTAGGTGTGGTTGGAAAAAGG - Intergenic
1118973143 14:70654208-70654230 TGGGAGGAGAGGTGTGAAAAGGG - Intronic
1119383972 14:74245775-74245797 TGGATGGAGTGGTGGGAAGCAGG - Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1121025344 14:90611616-90611638 TGGTAGGAGTGGTGGTATGGAGG - Intronic
1121239446 14:92418223-92418245 TGGGAGCAGGGGTGGGAGACAGG + Intronic
1122896159 14:104758136-104758158 TCGCAGGAGTGGGGGAAAACAGG + Intronic
1122970448 14:105150073-105150095 TGGTAGGGGTGGTGGGGAAGGGG + Intronic
1126772858 15:52075021-52075043 TGGAAGGAGTGGAGGGGAAGAGG - Intergenic
1128441184 15:67710231-67710253 TGGTTAGAGGGGTGGCAAACAGG - Intronic
1128513070 15:68325560-68325582 TGGTGGGTGGGGTGGGATACAGG - Intronic
1129552198 15:76464867-76464889 TGGTAGGAGTGTGGTGAAATTGG - Intronic
1132064887 15:98722678-98722700 AGGTAGGAGTGGTGGAAAGCTGG + Intronic
1133321821 16:4918874-4918896 TCCCAGGAGTGCTGGGAAACCGG + Intronic
1133410106 16:5561129-5561151 GGGCAGGAGGGGTGGGAAAATGG + Intergenic
1133879363 16:9766064-9766086 GGGTAGGAGTGGGGAGAAGCAGG - Intronic
1134231736 16:12435193-12435215 TGGGAGGAATAGAGGGAAACGGG - Intronic
1134354055 16:13464655-13464677 AGGTAGTAGTGGTAGTAAACGGG - Intergenic
1134895024 16:17878166-17878188 TGGTAAGAGTGTAGAGAAACAGG + Intergenic
1135003691 16:18800369-18800391 TGGAAGGAGAGTTGGGAAGCAGG + Intronic
1135228988 16:20687215-20687237 TGAAAGCAGTGGTGGGTAACAGG + Intronic
1136104474 16:28019848-28019870 TGGTAGGGGCTGTGGCAAACAGG - Intronic
1137026648 16:35482858-35482880 TGGTAAGAGTGTTGGGTATCAGG + Intergenic
1137447779 16:48542352-48542374 TGGTTGGAGTGTTGTGAAAGTGG - Exonic
1138647491 16:58435773-58435795 TGGGAGCACTGGTGGGAGACCGG - Intergenic
1139195284 16:64911079-64911101 TGGTAAGGGTGTGGGGAAACAGG + Intergenic
1139312910 16:66042316-66042338 TGGCAGGGGTGGTGGGGAAGGGG - Intergenic
1139783057 16:69367692-69367714 TGTTAGGAGAGGGGGCAAACTGG + Intronic
1143869593 17:9948837-9948859 TCCTAGGAGAGGTGGGAATCTGG - Intronic
1144033720 17:11344932-11344954 TGGTAGGAAAGGTCGGAAAGAGG - Intronic
1144922120 17:18772740-18772762 TGGTGGGGGTGGTGGGAGACGGG + Intronic
1145863635 17:28226964-28226986 GGGGGTGAGTGGTGGGAAACTGG + Intergenic
1145964214 17:28905348-28905370 TGGGAGGAGAGGAGGGAACCAGG + Exonic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149660846 17:58333258-58333280 TTGGAGGAGTGGCGGGAAAGAGG + Intergenic
1150432975 17:65133301-65133323 TGATGGGAGTGCTGGTAAACAGG + Intergenic
1151098708 17:71530718-71530740 TGGTGGTAGTGGTTGGAAAAAGG + Intergenic
1151566921 17:74903834-74903856 GGGGAGGTGGGGTGGGAAACCGG - Intergenic
1151671612 17:75574287-75574309 TGGCAGGAGGGGTGGGGAAGGGG + Intronic
1151936443 17:77264858-77264880 TGGTGGGGGTGTTGCGAAACGGG - Intergenic
1152344188 17:79741670-79741692 AGGGAGGGGTCGTGGGAAACAGG - Intronic
1153417799 18:4868614-4868636 TGGAGGGAGGGGTTGGAAACAGG - Intergenic
1155391808 18:25346779-25346801 GGAGAGGAGTGGTGGGAACCAGG - Intronic
1156178278 18:34573341-34573363 TGGCAGGAGAGGAGGGAAGCAGG - Intronic
1158475691 18:57777510-57777532 GGGTAGGAGAGTTGGGTAACTGG + Intronic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1158779745 18:60633130-60633152 TGTGAGGAGTGAAGGGAAACTGG + Intergenic
1159794329 18:72823343-72823365 AGGTAGGAGAGGTGTGAAAGAGG + Intronic
1162404877 19:10467638-10467660 GGGGAGGAGTGGAGGGGAACAGG - Exonic
1162939180 19:13997756-13997778 TGGTAGGAGTGGAGGCAGGCAGG + Intronic
1163582055 19:18144924-18144946 TGGTCGTTGTGGTGGGAAAGAGG + Intronic
1163653626 19:18532884-18532906 TGGTGGGACTGTTGGGACACAGG + Intronic
1164173334 19:22746554-22746576 TGGCAAGGGTGGTGGGGAACAGG - Intergenic
1164397453 19:27878458-27878480 TGGTACGATTGGAGGGAGACTGG - Intergenic
1165556494 19:36637077-36637099 TGGTAGAACTGTTGGGAAAAGGG - Intergenic
1165831774 19:38734125-38734147 TGGCAGGTGAGGTGGGAGACTGG - Exonic
1165850522 19:38847918-38847940 GGGTGTGAGTGGTGGGGAACAGG - Intronic
1165924367 19:39318173-39318195 TGGACAGAGTGGTGGGCAACTGG + Intergenic
1166979465 19:46624130-46624152 TGGCCGGTGTGGTGGGCAACGGG - Exonic
1167463328 19:49637769-49637791 TGGTAGGAGGGGTGGGGGGCAGG - Intronic
1167467865 19:49659593-49659615 TGGTTGAGGTGGTGGGGAACAGG + Exonic
924974351 2:159371-159393 TGGCAAGAGTGGTGGGGAATGGG + Intergenic
925354172 2:3225791-3225813 TGGTGGGAGGGGTTGGAAAGTGG - Intronic
926691946 2:15742741-15742763 TGGTAGGTGGGGTGGGGAAGGGG - Intronic
927910833 2:26898425-26898447 TGATAGGAGGGATGGGAAACTGG + Intronic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
928180728 2:29066606-29066628 TGGTAGGAGTCGTGGGTAAGTGG + Intronic
928676811 2:33658589-33658611 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
929002787 2:37364557-37364579 GGTGAGGAATGGTGGGAAACAGG + Intronic
929619472 2:43340156-43340178 AGGGAGGAGTGGAGGAAAACAGG + Intronic
931552458 2:63461842-63461864 TTGGAGGACAGGTGGGAAACTGG - Intronic
932666890 2:73705278-73705300 AGTCAGGAGGGGTGGGAAACGGG + Intergenic
932668816 2:73719284-73719306 AGTCAGGAGGGGTGGGAAACAGG + Intergenic
932696930 2:73964762-73964784 TGGTAGGAGTGATGGGAGATAGG - Intergenic
932972367 2:76560112-76560134 TGGTAGTAGTGGTGGGACATGGG - Intergenic
933175559 2:79169157-79169179 TGGCAAGAGTGGTGGGGAACAGG + Intergenic
933372940 2:81440397-81440419 TGGGGGGAGTAGTGGGAAGCAGG + Intergenic
933397224 2:81748949-81748971 TGGGAGGAGTGAAGAGAAACTGG + Intergenic
933656983 2:84896665-84896687 TGGTGAGAATGCTGGGAAACTGG + Intronic
934051410 2:88214397-88214419 GGGTAGGAGTGGGGAGAAACAGG + Intergenic
934907824 2:98221301-98221323 GGGCAGGGGTGGTGGGGAACAGG - Intronic
935748523 2:106210377-106210399 TGGTAAGGGTGGTGGGGAATGGG - Intergenic
935894891 2:107724789-107724811 TGAAAGGAATGGTGGGACACAGG + Intergenic
936387561 2:112043802-112043824 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
937150661 2:119683506-119683528 GGGTGGGAGTGGTGAGAAAGTGG - Intronic
937785959 2:125898458-125898480 GAGTAGGAGTGGTGGTAAGCAGG + Intergenic
939064388 2:137465134-137465156 TGGTAGCAGTGGTAGAAAAAAGG - Intronic
939493937 2:142906440-142906462 TGGCAAGAGTGGTGGAGAACGGG + Intronic
940135640 2:150432977-150432999 TGGTAGGGATTGTGGCAAACTGG + Intergenic
940278140 2:151961150-151961172 TGAGAGGAGTGGTGGGAACAGGG - Intronic
940318720 2:152351347-152351369 TGCTGGGATTGGTGGGAAAGGGG - Intronic
941165901 2:162082705-162082727 GGTGAGGAGTGGTGGGGAACAGG + Intergenic
941437733 2:165492183-165492205 AGGTAGAAGTGATGGGAAAAAGG - Intronic
941670269 2:168285368-168285390 TGGTGGGACTGGTAGGAAATAGG + Intergenic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
943291587 2:186078964-186078986 TGGTAAGAATGGTGAGAATCTGG - Intergenic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
943689470 2:190854652-190854674 TGTTAGGAGTTGTGGAAAACCGG - Intergenic
944534428 2:200695399-200695421 TGGGAGGAGCGGAAGGAAACTGG - Intergenic
944563989 2:200969058-200969080 TTGAAGTGGTGGTGGGAAACAGG + Intergenic
946493426 2:220171906-220171928 TGGTGGGGATGGTGGTAAACTGG + Intergenic
947268456 2:228307102-228307124 TGGTAGGATTGGAGGGGAACTGG + Intergenic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
1169282146 20:4277136-4277158 TGGTATGAGGGGTTGGCAACAGG - Intergenic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1171056362 20:21910698-21910720 TGGTAGGAGTGAGGGAAAAGAGG + Intergenic
1172360634 20:34310424-34310446 TGGTAAGAGTGTGGGGAAACAGG + Intronic
1173268158 20:41505901-41505923 AGGTAGGAGGGGTAGGAAAGGGG - Intronic
1174645324 20:52080440-52080462 TGCCAGGAGTTGGGGGAAACGGG + Intronic
1175896110 20:62336195-62336217 TGGAGGGAGTGGTGGGATATGGG - Intronic
1177231948 21:18333105-18333127 TGGTAGGAGGGAGGGGAATCAGG + Intronic
1179987489 21:44929778-44929800 TGGGAGAAGAGGTGGGACACAGG + Intronic
1180818639 22:18809517-18809539 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1181204862 22:21243972-21243994 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1182858704 22:33540510-33540532 TGGGAGGAGTGTTTGGAGACGGG - Intronic
1183340159 22:37275661-37275683 GGGTAGGAGCTGTGGGAAAAGGG - Intergenic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1203222063 22_KI270731v1_random:51443-51465 TGGCAGGAGTGATGGGAAAGGGG - Intergenic
1203268768 22_KI270734v1_random:35370-35392 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
950751711 3:15134243-15134265 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
951201004 3:19875448-19875470 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
952277136 3:31887896-31887918 TGGTGGCAGTGGTGGGACTCTGG - Intronic
954139128 3:48595924-48595946 TGGTAGGGGATGTGGGACACTGG - Intergenic
954709737 3:52499540-52499562 GGGCAGGTGTGGTGGGAAAGAGG - Intronic
955296628 3:57741267-57741289 GGGTAGGAGTGGTGACTAACAGG - Intergenic
957068897 3:75550062-75550084 TGGTGGTGGTGGTGGGAAAATGG - Intergenic
958442708 3:94175875-94175897 GGGTAGGAGTGGGGAGAAGCGGG - Intergenic
958630193 3:96673997-96674019 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
959567737 3:107849621-107849643 TGGTAGGAGTCGGGGGCACCTGG - Intergenic
960970262 3:123134556-123134578 TGGCAGGAGTGCTGGGAAGAGGG - Intronic
961122802 3:124387310-124387332 TAGAAGGAGTGGTGTGATACAGG + Intronic
961284512 3:125790265-125790287 CGGTGGTGGTGGTGGGAAACTGG + Intergenic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
963311171 3:143711782-143711804 TTGCTGGAGTGGTGAGAAACAGG - Intronic
963723073 3:148886463-148886485 TGGTGGTACAGGTGGGAAACAGG - Intronic
964914902 3:161828618-161828640 TGGAAGGAGAGGTTGGAAGCTGG + Intergenic
965179537 3:165384191-165384213 TGGTGGGAGTGGTGGGAGGTTGG + Intergenic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
965744433 3:171909387-171909409 TGGTAAGAATGTGGGGAAACTGG - Intronic
968249389 3:197192744-197192766 GGGTAAGGGTGGTGGCAAACAGG + Intronic
968391452 4:196279-196301 TGGCAAGGGTGGTGGGGAACAGG + Intergenic
969013231 4:4084599-4084621 TGGTGGTGGTGGTGGTAAACTGG - Intergenic
969799958 4:9556029-9556051 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
969927393 4:10597720-10597742 TGGGAGGAGTGGGTGGAAAGAGG + Intronic
971030718 4:22634684-22634706 GGGTAGGCGTGGAGCGAAACGGG + Intergenic
972145482 4:36019741-36019763 AGGTAGGAGTGGTGAGAAATAGG + Intronic
972179338 4:36444196-36444218 TGGGAAGGGTGGTGGGGAACAGG - Intergenic
973801532 4:54483280-54483302 GGGTAGGAGTGATGAGAAATGGG - Intergenic
974123000 4:57662744-57662766 TGGCAGGAGTGGTTGGTGACTGG - Intergenic
975869655 4:78765920-78765942 TGTTTGGAGTGGTGGGGACCAGG + Intergenic
975949125 4:79746858-79746880 TGCAAGGAGATGTGGGAAACAGG + Intergenic
977135891 4:93303513-93303535 TGCTAGTAGTGGTGTTAAACAGG - Intronic
977618263 4:99108750-99108772 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
979518479 4:121638834-121638856 TGGTGGGGGTGGGGGAAAACTGG - Intergenic
979832089 4:125315899-125315921 GGGAAGGGGTGGTGGGGAACCGG - Intergenic
980155029 4:129093687-129093709 TGGGAGGAGTCGTGAGAACCTGG + Exonic
980443981 4:132883468-132883490 TGGCAAGGGTGGTGGGGAACAGG - Intergenic
981289311 4:143056104-143056126 TGGCAGGACTGGTGGCAGACAGG - Intergenic
981435581 4:144717610-144717632 TGGAAGTAGTGGTGATAAACGGG + Intronic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
983667263 4:170195902-170195924 TGGCAAGGGTGGTGGGGAACAGG + Intergenic
984091284 4:175378510-175378532 TGGTAGCAGGGATGGGAAAGGGG - Intergenic
987370036 5:17184788-17184810 TGGCAGGAGTGGTGGGAGACGGG - Intronic
987422468 5:17736593-17736615 TGAGAGGGGTGGTGGGAAAATGG - Intergenic
987466732 5:18280690-18280712 TGGAAGGTGTGATGGGAACCGGG + Intergenic
987751581 5:22045797-22045819 TGGTAGGAGTGGTGGAGGACAGG + Intronic
988181091 5:27795303-27795325 TGGAAGAAGTGGTGGGTAATTGG - Intergenic
988740368 5:34063615-34063637 TGGCAAGGGTGGTGGGGAACAGG + Intronic
988996331 5:36718229-36718251 TGGTGGCAGTTGTGGGAAACTGG - Intergenic
989688175 5:44112525-44112547 TGGCAAGGGTGGTGGGGAACAGG - Intergenic
990318463 5:54606944-54606966 AGGTAGGAGTGGTTGTAAATGGG - Intergenic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
993690933 5:90998762-90998784 TGGCAAGAATGTTGGGAAACAGG - Intronic
994016990 5:94978691-94978713 TGGTAGTAGGGGTGGGGAATGGG + Intronic
994900125 5:105760585-105760607 TGGTCGGAGTGGGGGGTATCAGG - Intergenic
995465346 5:112445112-112445134 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
995894299 5:116994624-116994646 TGTGGGGAGTGGTGAGAAACAGG - Intergenic
996700539 5:126446284-126446306 AGGTAGGAGTGGTGGGCTACAGG + Intronic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997702080 5:135909611-135909633 GGATAGGAGTGGTGGGCACCAGG + Intergenic
998004752 5:138649524-138649546 TGGTGGAAGGGGTGGGAAATGGG - Intronic
998159686 5:139806356-139806378 TGGCAGGGGTCCTGGGAAACTGG + Intronic
998358526 5:141563061-141563083 CGGAAGGAGTTGTGAGAAACTGG - Intronic
1000855930 5:166398097-166398119 TGGTAGAAATGGTCAGAAACTGG + Intergenic
1001266333 5:170277141-170277163 TGGTGTGAGTTGTGGGAAAAGGG - Intronic
1001286578 5:170428069-170428091 GGGGAGGAGTGGAAGGAAACAGG - Intronic
1001289792 5:170448705-170448727 GGGAAAGAGGGGTGGGAAACAGG - Intronic
1001347256 5:170915558-170915580 TGGTAGGGGCTGTGGCAAACTGG + Intronic
1001367806 5:171161917-171161939 TGATAGCAGAGGTGGGGAACTGG - Intronic
1003118369 6:3298524-3298546 TGGGAAGGGTGGGGGGAAACTGG + Intronic
1004187147 6:13430665-13430687 TGGCAGGAGTAGTGGGACAGCGG + Intronic
1006081251 6:31568336-31568358 TGTTAGGAGTGGTGGTAAACTGG + Intergenic
1006683298 6:35812522-35812544 TGGAAGAAGTGGGGGGAAAGTGG + Intronic
1007010461 6:38412428-38412450 TGTTAAGAGTGTAGGGAAACAGG + Intronic
1008745197 6:54661353-54661375 TGGGAGGAGTGGTGGGAATGGGG - Intergenic
1010015022 6:71094756-71094778 AGGTAGTAGGGGTGGGATACAGG + Intergenic
1010451641 6:76010677-76010699 AGGTAGGAGAGTTGGGAAAATGG - Intronic
1010720432 6:79277335-79277357 TGGTAGAAGTGGCAGGAAACTGG + Intergenic
1010893396 6:81340014-81340036 GGGAAGGAGTGGGGGGAAGCTGG - Intergenic
1011076560 6:83444920-83444942 TGGCAAGGGTGGTGGGGAACAGG - Intergenic
1011506657 6:88051918-88051940 TGGTAGGAGTGATGTGTCACAGG - Intronic
1011540204 6:88420290-88420312 TGGCAAGGGTGGTGGGGAACGGG + Intergenic
1011677292 6:89747187-89747209 TGTTAGAACTGGAGGGAAACAGG + Intronic
1012736341 6:102949882-102949904 TGGTTGGAGTGGGAGGATACAGG - Intergenic
1013021937 6:106229313-106229335 TGGCAAGGGTGGTGGGGAACAGG - Intronic
1013837008 6:114344397-114344419 TGGTAAGAGTGGTGGGAGGAAGG - Intergenic
1013915042 6:115326764-115326786 TGGGAGGAGTGGGTGGATACAGG - Intergenic
1014943667 6:127472622-127472644 TGGCAGGTTTGGTGGGAATCTGG + Intronic
1014990601 6:128070663-128070685 TGGTATGAGTGGTGGTAGAGTGG - Intronic
1015919260 6:138250380-138250402 GGGAAAGAGTGGTGGGAAACAGG - Intronic
1017820994 6:158049016-158049038 TGGTAGGAGTGGTGGGGTGCAGG + Intronic
1018760740 6:166892321-166892343 TGGCAAGGGTGGTGGGGAACGGG - Intronic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021044735 7:15908615-15908637 TGGTAGTAGTGGCAGGAGACTGG - Intergenic
1021452335 7:20794919-20794941 TGGCAGGGGTGGTGGGAGAGTGG - Intergenic
1021490160 7:21211031-21211053 TGGTTGGCGGGGTGGGGAACAGG - Intergenic
1021931397 7:25584797-25584819 TTGTAGGAGTGGGGGGGACCCGG + Intergenic
1021963446 7:25894911-25894933 AGATATGAGTGGTGGGAGACGGG - Intergenic
1023439611 7:40172317-40172339 TGGCAAGGGTGGTGGGAAACGGG + Intronic
1023908972 7:44540722-44540744 TGGTAGTGGTGGTGGGAGTCGGG - Intronic
1023995932 7:45158764-45158786 TGGTACGGGAGGTGGGAAAAGGG + Intronic
1024608719 7:51045126-51045148 AGAGAGGAGTGATGGGAAACAGG - Intronic
1024613849 7:51090544-51090566 TGGGAGCACTGATGGGAAACTGG + Intronic
1024660641 7:51489973-51489995 TGGCAGGAGTGGTGGGACTTGGG - Intergenic
1024809706 7:53193630-53193652 TGGTATGAGTTGTGAGAAACAGG + Intergenic
1026467284 7:70665200-70665222 TGTTAGAAGTGGTAGGAAAATGG - Intronic
1029071876 7:97906236-97906258 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1030334396 7:108308766-108308788 TGGTGGGAGTGGTGAGAAGGGGG + Intronic
1030843815 7:114385101-114385123 TGGCAAGGGTGGTGGGGAACGGG + Intronic
1031651006 7:124290088-124290110 GGGTAGGAAAGGGGGGAAACGGG - Intergenic
1031882120 7:127209547-127209569 TGGCAGGAGTGGAGTGAACCAGG + Intronic
1033988624 7:147256740-147256762 TGAGGGGAGTGGTGGGGAACAGG + Intronic
1034426249 7:151015785-151015807 TGGGAGCAGTGGTGGGAATTTGG - Intronic
1035693967 8:1580027-1580049 TGGTATCAGTGCTGGGAAATGGG - Intronic
1036245816 8:7115760-7115782 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
1036888451 8:12578269-12578291 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1037248740 8:16867660-16867682 TGGAATGAGTGGAGGGAAAGAGG + Intergenic
1042055828 8:64764118-64764140 TGGCAAGAGTGGTGGGGAACGGG - Intronic
1043175436 8:77018825-77018847 TGGCAGGAGGGGTGGGAGAGGGG - Intergenic
1045546302 8:103131929-103131951 TGGTAGTGGTGGTGGGGAATAGG - Intergenic
1047549347 8:125852848-125852870 AGGTGGCAGTGGTGGGAATCCGG - Intergenic
1047951420 8:129939215-129939237 AGGAAGGAGTGGTGGGAGCCAGG + Intronic
1048269315 8:133015946-133015968 TGGCAGGGGTGGGGGGACACAGG - Intronic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050113461 9:2240367-2240389 TGGGTGGGGTGGTGGGAAGCAGG + Intergenic
1051182909 9:14429739-14429761 TGGTAGCAGTGGTGGGGAGGCGG - Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051432206 9:16991238-16991260 TGGGAGGAATGGTGGGGAGCAGG - Intergenic
1053414454 9:37938257-37938279 TGGTAGGAATGGTGGGATTCAGG + Intronic
1054737767 9:68772829-68772851 TGGTAAGAGTAGTGGAAAACGGG + Intronic
1055307682 9:74947151-74947173 TGAGAGGAATGGAGGGAAACAGG + Exonic
1055399171 9:75905141-75905163 TGGAAGGGTTGGTGGGAAATGGG + Intronic
1055711537 9:79067336-79067358 TGGCAGGAGTGGAGTGAACCAGG - Intergenic
1056089977 9:83195897-83195919 TGATAGGAGTAGTGGGAAGTGGG + Intergenic
1056251496 9:84753137-84753159 AGGGAGGAGTGGTGGTAAATTGG + Intronic
1056254154 9:84781201-84781223 TGATAGGAGTTTTGAGAAACTGG + Intronic
1056830651 9:89914574-89914596 TGGTGGGAGTGTGGGAAAACAGG - Intergenic
1056850884 9:90082608-90082630 TGGATGGACTGGTGGGAACCAGG + Intergenic
1057402497 9:94737024-94737046 GGGTAGTAGTGGGGAGAAACTGG + Intronic
1058574605 9:106387084-106387106 TGCCAGCAGTGTTGGGAAACTGG + Intergenic
1058829695 9:108804901-108804923 TGTTAGGGGTGGGGGGAAAGGGG + Intergenic
1060575173 9:124685328-124685350 TGGGAGGAGTTGGGGGAGACAGG + Intronic
1061484396 9:130912966-130912988 GGGTCGGGGTGCTGGGAAACCGG + Intronic
1061491506 9:130947399-130947421 TGGCAGGAGTGGTGCCAAGCGGG - Intergenic
1061739716 9:132692456-132692478 GGGTGGGAGTGAGGGGAAACAGG - Exonic
1061879791 9:133562866-133562888 TGGGAGGCGTGGTGGGCACCCGG + Intronic
1062306357 9:135908909-135908931 TGGAAGGACTGGTAGGAAATGGG + Intergenic
1062327055 9:136017504-136017526 TGGTGGGGGTGGGGGGCAACAGG - Intronic
1062355659 9:136160781-136160803 TGGAAGGAGGGGCGGGAAGCTGG + Intergenic
1186609729 X:11127397-11127419 TGGGAGGGGTGGTAGGACACAGG - Intergenic
1187087744 X:16059331-16059353 GGGGAGGAGTGGTGGGGAATAGG + Intergenic
1187286907 X:17914459-17914481 TGGTAGGGGTTGGGGGATACAGG - Intergenic
1187296202 X:18003244-18003266 AGCTATCAGTGGTGGGAAACTGG + Intergenic
1189001103 X:36947953-36947975 TGGGAAGGGTGGTGGGGAACTGG - Intergenic
1189202209 X:39206109-39206131 TGGAAGGAGTGGCATGAAACGGG + Intergenic
1189701401 X:43718354-43718376 GGGTAGTAGTGGGGGAAAACAGG + Intronic
1190059363 X:47201030-47201052 TGGTAGGAGTTGGGGGAAAAGGG - Intronic
1190326528 X:49210160-49210182 TGGACGGGGTGGGGGGAAACAGG + Intronic
1190482449 X:50890325-50890347 TGGTGGCAGTGGTGGCAGACTGG - Intergenic
1192079231 X:68031597-68031619 TGATAGTAGGGGTGGGAAAGAGG + Intergenic
1192422855 X:71049365-71049387 TGGCAGGAGTGTAAGGAAACAGG + Intergenic
1192699990 X:73458665-73458687 TTGTATGAGTGGTGGGGAAGTGG - Intergenic
1192711008 X:73588270-73588292 TGGGAGGATTGGAGGGAAATTGG - Intronic
1192940207 X:75903873-75903895 TGGCAAGGGTGGTGGGGAACAGG + Intergenic
1193306415 X:79957096-79957118 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
1194644740 X:96445671-96445693 TGGAAGAAGTAGTGGGAAACAGG - Intergenic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195584771 X:106552408-106552430 TGGCAAGGGTGGTGGGGAACGGG - Intergenic
1195606404 X:106810278-106810300 TGGTAGAAGTGGTGGGAGGAGGG + Intronic
1195652022 X:107294895-107294917 TGGTAGGAATGTAGAGAAACTGG - Intergenic
1195732857 X:107982831-107982853 TGGGAGGAGTGTGGGGAAAGAGG - Intergenic
1196129141 X:112134220-112134242 TGGTTGGAGGGGTGGGAATCTGG - Intergenic
1197488955 X:127091908-127091930 TAGTAGGAGATGTGGAAAACTGG + Intergenic
1197756856 X:130001708-130001730 TGGTGAGAGTGGTGGGGAAATGG + Intronic
1197772426 X:130097910-130097932 TGGCAGGAGAGGGGGGAAACCGG - Intronic
1197791888 X:130263545-130263567 TGGGAGGGTTGGTGGGAAATGGG + Intronic
1197882216 X:131178640-131178662 TGATATGAGTGGTGGAAGACTGG + Intergenic
1198178068 X:134174571-134174593 TGGGAGGAGGGGTGGGAGATGGG - Intergenic
1199694072 X:150331164-150331186 TGGTATGTGATGTGGGAAACAGG + Intergenic
1200661199 Y:5958913-5958935 TGGGAGGAGTAGTGGGGCACTGG + Intergenic