ID: 997368232

View in Genome Browser
Species Human (GRCh38)
Location 5:133339327-133339349
Sequence CACCTCTGGCAACTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997368222_997368232 20 Left 997368222 5:133339284-133339306 CCTATCATGGTAGTGCAACCCTG 0: 1
1: 0
2: 4
3: 97
4: 1725
Right 997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG No data
997368226_997368232 2 Left 997368226 5:133339302-133339324 CCCTGAATAGGGAGCAGGAATAG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG No data
997368227_997368232 1 Left 997368227 5:133339303-133339325 CCTGAATAGGGAGCAGGAATAGG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG No data
997368221_997368232 21 Left 997368221 5:133339283-133339305 CCCTATCATGGTAGTGCAACCCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997368232 Original CRISPR CACCTCTGGCAACTGGGCAC AGG Intronic
No off target data available for this crispr