ID: 997370056

View in Genome Browser
Species Human (GRCh38)
Location 5:133353837-133353859
Sequence GAGGCCAGTTCTTTGAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997370052_997370056 3 Left 997370052 5:133353811-133353833 CCTCTGGGTTGCAGTGGCACTTC 0: 1
1: 0
2: 1
3: 18
4: 171
Right 997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG 0: 1
1: 1
2: 1
3: 19
4: 183
997370050_997370056 10 Left 997370050 5:133353804-133353826 CCACGGGCCTCTGGGTTGCAGTG 0: 1
1: 0
2: 2
3: 21
4: 329
Right 997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG 0: 1
1: 1
2: 1
3: 19
4: 183
997370045_997370056 28 Left 997370045 5:133353786-133353808 CCTGCGGGGCTTTGTTCACCACG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG 0: 1
1: 1
2: 1
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997370056 Original CRISPR GAGGCCAGTTCTTTGAGCAG CGG Intronic
900663112 1:3795920-3795942 GCCGCCAGTTCACTGAGCAGGGG + Exonic
901915580 1:12496942-12496964 GAGGTCAGTTCCTTGGGCAAAGG - Intronic
902232301 1:15035896-15035918 GAGGCCCCTTTTTTGAACAGTGG + Intronic
902516756 1:16993708-16993730 GTGGCCAGTGCTCGGAGCAGGGG + Exonic
903300796 1:22377248-22377270 GAGGCCTCTTCCTTGAGCAGAGG + Intergenic
903764611 1:25726120-25726142 GAGGTCAGTGCTCAGAGCAGTGG + Intronic
904869222 1:33606138-33606160 GAGGCCAGTCCATTGGGGAGAGG + Intronic
904935056 1:34124247-34124269 GAGGCTTGTTCTGTGAGCTGAGG + Intronic
912697791 1:111854600-111854622 GAGGCTGGTTCTCTGAGGAGTGG + Intronic
912701760 1:111883074-111883096 GTGGCCAGTTGTTTGGGCAATGG - Intronic
914459801 1:147872888-147872910 GAGTCCATTTCTTTGAGAAGAGG + Intergenic
914853028 1:151328735-151328757 GAGGCTAGTTATTTGAGCCCGGG + Intergenic
915216818 1:154345990-154346012 GAAGGCAGTTCTTTCAGCCGGGG + Intronic
918341313 1:183570100-183570122 GAGGGCGGTTTTCTGAGCAGGGG - Intronic
919840255 1:201603826-201603848 GAAGCCAGGTCTTTGGGCATCGG + Intergenic
920842026 1:209563128-209563150 TGGGGCACTTCTTTGAGCAGTGG + Intergenic
922341497 1:224659610-224659632 GAAACGAGTACTTTGAGCAGGGG + Intronic
922604049 1:226878029-226878051 GAAAGCAGTTCTGTGAGCAGAGG - Intronic
1063114731 10:3066167-3066189 GAGGCCTGTTCTATGAACCGGGG - Intergenic
1064795205 10:19004310-19004332 CAAGCCAGTTCTTTGAGTGGGGG - Intergenic
1066705771 10:38175933-38175955 GAGGCCAAAGCTGTGAGCAGAGG + Intergenic
1067432361 10:46252749-46252771 GAGGCCCGTTCTCTTTGCAGAGG - Intergenic
1069870303 10:71528864-71528886 GATGATAGGTCTTTGAGCAGGGG + Intronic
1070742339 10:78911306-78911328 GAGGCCAGTTCAGTGAGGAGTGG - Intergenic
1071089114 10:81898218-81898240 GAAGCCAAGTGTTTGAGCAGTGG + Intronic
1071550173 10:86560620-86560642 GAGGCCAACCCTTAGAGCAGAGG - Intergenic
1072623025 10:97093049-97093071 GAGGGCAGTTTTTTGTACAGTGG - Intronic
1072695474 10:97599962-97599984 GAGGGCATCTCTTTGAGCACTGG + Intronic
1074913107 10:117929667-117929689 GAGGCGAGTTCCTTGAGAACAGG - Intergenic
1075094198 10:119460535-119460557 GAGGCCTTGGCTTTGAGCAGGGG + Intergenic
1075649701 10:124119428-124119450 GTGGCCAGTTCTGTGTTCAGAGG - Intergenic
1076544544 10:131236494-131236516 AAAGACAGTTCTGTGAGCAGCGG - Intronic
1077598178 11:3552796-3552818 GAGGCCAGGAGTTTGAGCACAGG - Intergenic
1078929703 11:15903668-15903690 AAAGCCTGTTCTGTGAGCAGAGG - Intergenic
1079080171 11:17408431-17408453 AATGCCAGCTCTTTGAGCACTGG - Exonic
1079104275 11:17560489-17560511 GTGGGCAGTTCTCTGAGCAAAGG + Intronic
1083267130 11:61551887-61551909 GTGGCCAGTGATGTGAGCAGTGG + Intronic
1083329765 11:61891908-61891930 GAGTCCCGGTCTGTGAGCAGCGG + Intronic
1084618489 11:70252232-70252254 GAGGCCTGTTTCTTGGGCAGTGG - Intergenic
1084967048 11:72750333-72750355 GAGGCCACTTGTTTGGGCAGTGG + Intronic
1086061591 11:82705769-82705791 GAGGCAGGTTCTTTGTGCATTGG + Intergenic
1086877352 11:92112464-92112486 GTGGGCATTTCTTTCAGCAGAGG + Intergenic
1088502084 11:110492675-110492697 GAGGTGAGTTCTGTGAGCTGTGG - Intergenic
1089017065 11:115174239-115174261 GATGCCAATTCTGTGAGCAATGG + Exonic
1090642409 11:128740793-128740815 GAGGCCACTTCTTAGAGTTGGGG + Intronic
1091665355 12:2414909-2414931 AAGGCCAGTTCTTTTCCCAGGGG + Intronic
1092922473 12:13244956-13244978 GCGGCCAGTGGTTTGACCAGAGG - Intergenic
1093698314 12:22188753-22188775 GAGGGCAGGTCTTCTAGCAGTGG + Intronic
1096216869 12:49802768-49802790 AAGGCCAGGTCTCTGAGCAGTGG - Intronic
1096653530 12:53074401-53074423 GAGGCAAGTTAGTGGAGCAGAGG - Intronic
1097982374 12:65747427-65747449 ATGTCCAGTTCTGTGAGCAGTGG - Intergenic
1098126856 12:67305600-67305622 GAGGCCTGTTCTGGGAGAAGGGG + Exonic
1100439606 12:94604425-94604447 GACTCCAGTTCTTTCAGCACAGG - Intronic
1101140658 12:101792281-101792303 GAGGCGAGTTCCCTGAGCAGAGG + Intronic
1104689588 12:130815329-130815351 GAGGCCAGTTCTTTGTTGTGTGG - Intronic
1104690958 12:130826171-130826193 GAGGCAAGTGCCTAGAGCAGAGG - Intronic
1108573376 13:51771179-51771201 GAGACCAGTTCTTGGCGCCGCGG + Intronic
1113151946 13:107273802-107273824 GAGGGCACTTCTTAAAGCAGTGG + Intronic
1114128801 14:19764336-19764358 GAGGCCAGTGCTATAATCAGGGG + Intronic
1114999771 14:28407862-28407884 GAAGTAAGTTATTTGAGCAGAGG + Intergenic
1121069051 14:90999572-90999594 GAAGCCAGTTCTCACAGCAGCGG + Intronic
1122126470 14:99581213-99581235 GAGCCCAGTGGTTTGAGCATGGG - Intronic
1122176718 14:99926240-99926262 GAGGGCAGTTCTTCTAGCTGTGG - Intronic
1123140030 14:106067207-106067229 GAGGCCAAACCTTTGAGGAGAGG + Intergenic
1125409467 15:39390237-39390259 GATGCCATTTCTTTGAGCCTCGG - Intergenic
1125538482 15:40456437-40456459 GGGGCCTGGTCTCTGAGCAGTGG + Intronic
1128361332 15:66963860-66963882 GAGGTCAGTGGTTTGACCAGTGG - Intergenic
1129819904 15:78592445-78592467 AAGGCCATTTCCTTGACCAGGGG - Intronic
1130048096 15:80461582-80461604 GAGGTCAGTCCTGGGAGCAGAGG + Intronic
1130391604 15:83460348-83460370 GAAACCAGTACCTTGAGCAGTGG - Intronic
1130867917 15:87948001-87948023 GAGGGCAGTTCTTTGAGGGCTGG - Intronic
1131921135 15:97329862-97329884 TAGGCCACTTCTTTCAGCAGAGG - Intergenic
1132957787 16:2604941-2604963 GAGGTCAATTCTCTGAGTAGAGG - Intergenic
1132970248 16:2684017-2684039 GAGGTCAATTCTCTGAGTAGAGG - Intronic
1137002017 16:35237393-35237415 GAGGCCAGTCCTCAGTGCAGTGG - Intergenic
1137714793 16:50592112-50592134 CAGGCCTGTGTTTTGAGCAGGGG + Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139514684 16:67446181-67446203 GTGGCCAGTGCTTTGAGCCGTGG - Intronic
1140395519 16:74623169-74623191 GAGGCCAGTTGTTTGAGCGGTGG - Exonic
1141879756 16:86850027-86850049 GAGACAAGGTCTTAGAGCAGCGG - Intergenic
1142199580 16:88754682-88754704 AAGGCCAGGATTTTGAGCAGGGG + Intronic
1144476665 17:15594840-15594862 AATGCCTGTTCTTTGACCAGTGG - Exonic
1144921587 17:18768562-18768584 AATGCCTGTTCTTTGACCAGTGG + Exonic
1146538476 17:33673837-33673859 GAGACCTGTCCTTTGAGCTGGGG + Intronic
1146794228 17:35769951-35769973 GAGGCCAGATCTATGAGCTTAGG + Intronic
1148738118 17:49876108-49876130 GAGGCCAGTGCTTTGATCTGTGG - Intergenic
1149294034 17:55244606-55244628 AAGTCCAGCTCTTAGAGCAGTGG + Intergenic
1149355335 17:55833781-55833803 GAGGCAAGGTCTTTCAGCGGGGG - Intronic
1152666720 17:81574640-81574662 GAGGCCACTTCTGGAAGCAGTGG + Intronic
1153690687 18:7590335-7590357 GAGGTCAATTCATTGATCAGTGG + Intronic
1156360430 18:36379969-36379991 GAAGAAAGTTCTTTGAGGAGTGG + Intronic
1162784785 19:13027810-13027832 GAGGCCACTTCTCTGGGCTGGGG + Intronic
1163152446 19:15423261-15423283 GTGGCCAGTGCTGTGAGGAGAGG + Intronic
1165064498 19:33221086-33221108 GAGCCCTGGGCTTTGAGCAGAGG - Intronic
1165792000 19:38498259-38498281 GAGGCCAGGATTCTGAGCAGAGG + Intronic
1165912243 19:39236692-39236714 GAGGCTGGATCTGTGAGCAGAGG + Intergenic
1168646145 19:58060201-58060223 GAGGCCAGTTGTGCGAGTAGAGG - Intronic
926031251 2:9591653-9591675 GAAGCATGTTCTTAGAGCAGGGG + Intronic
926492113 2:13537509-13537531 GAGGACAGTTGTTTGAGGAGGGG + Intergenic
928665941 2:33550777-33550799 AAAGCCAGTTCTTTGAGCATGGG - Intronic
929266840 2:39928114-39928136 GAGGTCATTTATTTGGGCAGTGG - Intergenic
930028611 2:47044882-47044904 GAGCCCAGGTCTTAGGGCAGAGG + Intronic
930855957 2:56018330-56018352 GAGGCCCTTTCTCTGAGCACAGG + Intergenic
930920788 2:56751118-56751140 GAGGTAAGTTCTTTGGGCAACGG - Intergenic
932222188 2:70008456-70008478 GAGGCCAGGTCTGGCAGCAGAGG + Intergenic
932640840 2:73444262-73444284 GAGGGAATTTCTTTGAGTAGGGG + Intronic
932870635 2:75394614-75394636 GTGGGCAGAACTTTGAGCAGTGG - Intergenic
934759382 2:96845017-96845039 GAGGCCAGTTCTTTGGGAGCTGG - Intronic
937266087 2:120615415-120615437 GAGGCCAGTTTTTAGTGAAGTGG - Intergenic
939443698 2:142281329-142281351 GTGGCATGTTCTCTGAGCAGAGG + Intergenic
942266785 2:174235421-174235443 GAGGGCAGTTCTTGTAGCAGAGG - Intronic
942393377 2:175520129-175520151 GGGTCCTCTTCTTTGAGCAGTGG + Intergenic
945216542 2:207440297-207440319 GAGGCCTTTTCTTTGAGCATGGG - Intergenic
946201652 2:218074015-218074037 GAGGCCAGTGTGTGGAGCAGGGG + Intronic
946666979 2:222060679-222060701 CAGTCCAGTTTTTTGAGCTGCGG + Intergenic
948978803 2:241482067-241482089 CATGCCAGTTATTTGAGCAGAGG + Intronic
1169247858 20:4037997-4038019 GAAGCCAGTGCTGTGAGAAGGGG + Intergenic
1173478253 20:43378589-43378611 GATGCCACTGCTTTGGGCAGTGG - Intergenic
1176242820 20:64083000-64083022 GAGGGCAGTGCTGTGGGCAGCGG - Intronic
1177569527 21:22870139-22870161 GTGGGCAGAACTTTGAGCAGTGG - Intergenic
1178199391 21:30386902-30386924 GAGGACAGGGCTTTGAGCATGGG - Intronic
1182333661 22:29569035-29569057 CAGGACAGGTATTTGAGCAGGGG + Intronic
1182379101 22:29872084-29872106 GAGGCCAATTGTTTTTGCAGAGG - Intergenic
1185259822 22:49855253-49855275 GAGGCCCGGTCTTTGAGGTGAGG + Intronic
954663905 3:52240329-52240351 GAGGCCAGCTTTTTGGGCTGGGG + Intergenic
954934433 3:54313571-54313593 GAGGCCAGTGAAGTGAGCAGAGG - Intronic
956807508 3:72830743-72830765 AAGAACAGTTCTTTGAGAAGTGG + Intronic
960779873 3:121308094-121308116 GGGGCCTGTTGTTGGAGCAGGGG + Intronic
964367293 3:155963954-155963976 GTGGCCAGGTCTCTGAGCATAGG + Intergenic
966252561 3:177882819-177882841 GAGTGCATTTGTTTGAGCAGGGG + Intergenic
966871598 3:184293441-184293463 GAGGCCAGGGCTTTGAGCTCTGG - Intronic
967434718 3:189430951-189430973 GAGGGCAGCTCTCTGAGCACTGG - Intergenic
968310436 3:197678348-197678370 GAAGCCAGTTGTTAGAGCATAGG - Intronic
969112263 4:4851471-4851493 GAGTTCAGTTCTTGGAGCAGGGG - Intergenic
971931473 4:33089610-33089632 GAGGCCAGTTTTTGGTGTAGGGG - Intergenic
973167612 4:47096785-47096807 GAGGAAAGGTCTATGAGCAGAGG + Intronic
976824183 4:89241071-89241093 AAGGTCAGTTCTTTGACCACTGG - Exonic
978368428 4:108006511-108006533 GAGCACAGATCTTAGAGCAGTGG + Intronic
979655709 4:123190996-123191018 GAGGGCATTTCTTAGAGCAATGG - Intronic
980902113 4:138914903-138914925 GAGCCCAGTGTTTTGATCAGGGG - Intergenic
982123198 4:152161346-152161368 AGGACCAGTTCTCTGAGCAGGGG - Intergenic
985573825 5:664607-664629 GAGGCCTGTCCTGTGTGCAGCGG - Exonic
987083960 5:14451792-14451814 GAGGCAAGTTCTTGAAGCAAAGG - Intronic
988911934 5:35852072-35852094 GAGGCAAGTACTGTGTGCAGGGG + Intergenic
991384336 5:66068242-66068264 GAGGCAAGATCTTTGAGCCCAGG + Intronic
995438152 5:112160632-112160654 GTGGCCAGTTCTTTCCACAGAGG - Intronic
997051756 5:130389877-130389899 GAGAGCACTTCTCTGAGCAGTGG - Intergenic
997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG + Intronic
1000117567 5:158167767-158167789 GAGGTGACTTCTTCGAGCAGGGG - Intergenic
1001741484 5:174056440-174056462 GAGGCCAGTCATTTGATCACAGG + Intronic
1002762184 6:210561-210583 CAAGCCATTTGTTTGAGCAGAGG - Intergenic
1003174204 6:3743255-3743277 GAGGCCTGTTCTTTGGGTAGTGG - Intronic
1004608207 6:17213686-17213708 GAGAGCTGTTCTTTTAGCAGAGG - Intergenic
1005590307 6:27317981-27318003 GAAGCCAGATCTCTGAGGAGGGG + Intergenic
1006301219 6:33194375-33194397 AAGGCCAGTGCTTTGTGCTGGGG + Exonic
1011980218 6:93365496-93365518 GAGGTCAGTTCTTTGAGCAGTGG - Intronic
1012555284 6:100504247-100504269 GAAGCCTGTTTTTTAAGCAGTGG - Intergenic
1014817627 6:125953042-125953064 CTGGCCAGTTCATTGAGCTGCGG + Intergenic
1016885505 6:148956065-148956087 GAGGCCAGTTCTGACACCAGAGG - Intronic
1017209181 6:151835996-151836018 TATGACAGTTCTTTGGGCAGTGG + Intronic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1020180647 7:5919902-5919924 GAGGCCAGCACTGTGAGCTGGGG - Exonic
1020302282 7:6804980-6805002 GAGGCCAGCACTGTGAGCTGGGG + Exonic
1020414598 7:7931288-7931310 AAGGCCTTTTCTTTGAGCACAGG + Intronic
1021769473 7:23984237-23984259 GAAGGCAGTTCTTTGGGCACTGG - Intergenic
1025022573 7:55491369-55491391 GTGGTCAGTTCTAGGAGCAGTGG - Intronic
1029582911 7:101449191-101449213 GATGCCAGGTTTCTGAGCAGTGG + Intronic
1031118394 7:117692913-117692935 GAGGTCAGGTCTTGCAGCAGAGG - Intronic
1032163741 7:129529783-129529805 GGGGGCAGTTCTTTGTGAAGAGG + Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032381470 7:131487628-131487650 GAGCTGAGTTCTTTGAGCATAGG - Exonic
1032451043 7:132031335-132031357 GATGCCAATTCTTGGAGCAGTGG + Intergenic
1032887998 7:136163098-136163120 TAGGCAAGTCCTTAGAGCAGAGG + Intergenic
1033801655 7:144909089-144909111 GAGCCCTGATCTTTGAGCTGTGG + Intergenic
1034919287 7:155066090-155066112 GTGGCCAGGGCTTTGAGCTGAGG + Intergenic
1036428917 8:8671495-8671517 GAGGCCAGTTGTTGGGGAAGAGG + Intergenic
1038777924 8:30547662-30547684 GAGGCCAGGTCCTGGAGCCGAGG + Intronic
1039411734 8:37360482-37360504 GAGGAAAGTCCTTTCAGCAGTGG + Intergenic
1041311914 8:56525846-56525868 GAGGGCAATTCTTTGAGGACAGG - Intergenic
1045292815 8:100848311-100848333 GAGGCCATTTCTGTTATCAGAGG - Intergenic
1045430052 8:102105365-102105387 GTGGCCATTTCCCTGAGCAGGGG - Intronic
1048016652 8:130503218-130503240 AAGGACAGTTCAGTGAGCAGGGG + Intergenic
1048963571 8:139599198-139599220 GAGGCCAGTTCCTTGGGGTGGGG + Intergenic
1049189755 8:141280498-141280520 GGGGCCAGCTCTGAGAGCAGTGG + Intronic
1049268373 8:141681477-141681499 GGGGCCAGGACTCTGAGCAGAGG + Intergenic
1049948043 9:617207-617229 GAGTCCAGTTCTTTTGGCAGTGG + Intronic
1051605474 9:18914009-18914031 CAGCCCAGTTCTTTTAGCAAAGG - Intergenic
1051769840 9:20565479-20565501 GAGGACAGTACTTATAGCAGTGG - Intronic
1052657202 9:31377615-31377637 GAGGCCAGTGCTGTCAGGAGAGG + Intergenic
1056404181 9:86258472-86258494 GAGGGCCGTTCTTTGGGCAAGGG - Intronic
1056602416 9:88056517-88056539 GAGGCCAGTCCCTGAAGCAGTGG + Intergenic
1058733639 9:107874547-107874569 GAAGCCACTTCTTTGGCCAGTGG - Intergenic
1059256893 9:112939076-112939098 CAGGGCAGTTCTGAGAGCAGGGG - Intergenic
1060568404 9:124614742-124614764 GTAGCCAGTTCATTGAGGAGGGG - Intronic
1061938861 9:133873446-133873468 GAGGCCAGTGTCTTCAGCAGGGG - Intronic
1190336688 X:49266986-49267008 CAGGCCAGTTCTATCAGCAGAGG + Intergenic
1193469912 X:81887610-81887632 GAGACCAGTCTTTTGAGCTGCGG - Intergenic
1194498887 X:94655563-94655585 GAGGCAAGATTTTAGAGCAGGGG - Intergenic
1200962757 Y:9010186-9010208 GAGGTTAGTTCTTTGAGAACTGG - Intergenic
1201277829 Y:12315027-12315049 TAGCACAGTTCTTTGAGGAGGGG - Intergenic
1201859204 Y:18576211-18576233 GAGACCATTTCTTTGTTCAGTGG + Intronic
1201874118 Y:18744170-18744192 GAGACCATTTCTTTGTTCAGTGG - Intronic
1202256664 Y:22928505-22928527 GAGGCCAGTTCATTCACCATGGG - Intergenic
1202409655 Y:24562258-24562280 GAGGCCAGTTCATTCACCATGGG - Intergenic
1202461128 Y:25107819-25107841 GAGGCCAGTTCATTCACCATGGG + Intergenic