ID: 997370970

View in Genome Browser
Species Human (GRCh38)
Location 5:133359740-133359762
Sequence TTTTAAAAGCTGAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 430}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997370970_997370973 0 Left 997370970 5:133359740-133359762 CCACCCTCATTCAGCTTTTAAAA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 997370973 5:133359763-133359785 GCATTTCCTTTACTCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997370970 Original CRISPR TTTTAAAAGCTGAATGAGGG TGG (reversed) Intronic
902096735 1:13951812-13951834 TTATAAAAGCAGAAAGTGGGTGG - Intergenic
902645620 1:17796002-17796024 CTTTAAAAGCTGAGCTAGGGAGG + Intronic
904762372 1:32815051-32815073 CTTTAAAACCTGAGTGAGGCCGG + Intronic
905150111 1:35920543-35920565 TTTAAAAAGCTCAATGAATGAGG - Exonic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
906077184 1:43060655-43060677 CTTTAAAAGGTGAATAAGGCCGG + Intergenic
906208123 1:43997731-43997753 TTTCAAACGCTGCATGAGGTAGG + Exonic
907908649 1:58808247-58808269 TTTTGACAGATGAATGAGGAGGG + Intergenic
908432951 1:64076922-64076944 TTTTAAAAGCTGTGTGACGTTGG + Intronic
908686421 1:66725184-66725206 ATTTAACACCTGAGTGAGGGAGG + Intronic
909167721 1:72249725-72249747 TTTTGAAAGGAGAAAGAGGGAGG + Intronic
909816699 1:80003701-80003723 TTTTAGAAGATGAATGATAGAGG + Intergenic
910449331 1:87330264-87330286 TTTTAAAAGGAGAGTGAGGGAGG - Intronic
910610578 1:89137309-89137331 TTTTAAAATCAGAATGATGCTGG - Intronic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
912134475 1:106643596-106643618 TTTTAAAGACAGAATGAGGCTGG + Intergenic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
912986759 1:114441151-114441173 TTTTAAAAAATGACTGGGGGTGG + Intronic
913475152 1:119229981-119230003 ATTTAGAAGCTGCATGAGTGAGG - Intergenic
913716628 1:121541416-121541438 TTGTAACAGCTCAATGAGGTGGG + Intergenic
914932639 1:151948775-151948797 TTTTAAAGGATAAAAGAGGGGGG - Intergenic
915617595 1:157051488-157051510 TTTTAAAAGCAGGATTTGGGCGG - Intergenic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916241124 1:162641050-162641072 TTAAAACAGCTCAATGAGGGTGG - Intronic
917327585 1:173849235-173849257 TTTTAAAAGCTGGTTGGGGCCGG + Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918344362 1:183593324-183593346 TTTTAAAAGCTCAATCTGGATGG - Intronic
918739230 1:188106124-188106146 TTTTAAAATCTGAACTAGTGAGG - Intergenic
919383125 1:196882968-196882990 TTTAAAAAGCTGGTTTAGGGAGG + Intronic
919467803 1:197943717-197943739 TTTTGGAAGCTGAGTTAGGGCGG - Intergenic
919633614 1:199982806-199982828 TCTTAAAAGATAAATGAGTGGGG - Intergenic
920752143 1:208688919-208688941 TCTTAAAAGATGAAGGAAGGGGG + Intergenic
922594164 1:226800921-226800943 TTTTGAAAGATGAATGAGAATGG - Intergenic
923285930 1:232495261-232495283 TTTTAAAAGATGAAAGGTGGGGG + Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
1063118242 10:3086078-3086100 TTTTAAAAGCTGTTTGGGGATGG + Intronic
1063666635 10:8064856-8064878 TTTTAAAAGAATAATGAGAGAGG - Intronic
1065380299 10:25083491-25083513 TTTTAAAAATTTGATGAGGGAGG + Intergenic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065571776 10:27078422-27078444 TTTTAAAAGATGAAAGAGTAGGG + Intronic
1065665263 10:28052314-28052336 TTTTAAAAAATGAAAGAGGGAGG - Exonic
1066023401 10:31325661-31325683 ATTTTAAATCTGAATGGGGGAGG - Intronic
1067189240 10:44056062-44056084 CATTAAAAGCTGAATGCGAGGGG - Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1068222471 10:54061926-54061948 CTTTAAAAACTAAATGAGGCCGG + Intronic
1068792565 10:61043256-61043278 TATAAAAAGCTGCATGAGGTTGG + Intergenic
1068929281 10:62572667-62572689 TTTTAAAAGCAGAATCACTGGGG - Intronic
1069666006 10:70159395-70159417 TTTTAAAAACTGTATTAGGCTGG + Intronic
1070045801 10:72834946-72834968 TTTTAACAGATAAATGAGGCTGG - Intronic
1070869225 10:79734566-79734588 TCTGAAAATCTGAATAAGGGAGG - Intergenic
1071636138 10:87256743-87256765 TCTGAAAATCTGAATAAGGGAGG - Intergenic
1071659103 10:87481203-87481225 TCTGAAAATCTGAATAAGGGAGG + Intergenic
1072621530 10:97082728-97082750 TTTTAAGAACTAAATGAGGCTGG - Intronic
1073197797 10:101708137-101708159 TTTTAACTCCTGAATGAGGTTGG + Intergenic
1073261935 10:102197054-102197076 TATGAAAAGCTGAACGGGGGTGG - Intergenic
1073640751 10:105250259-105250281 TTTTGACAGATGAATGGGGGTGG + Intronic
1073706172 10:105986932-105986954 TCTTAAATGATGAAGGAGGGAGG + Intergenic
1073797004 10:106999733-106999755 TTGTAAAACCTGAATTAAGGAGG - Intronic
1074810285 10:117098090-117098112 TTTTAAAAGATGCCTGAGGCCGG + Intronic
1075198623 10:120382782-120382804 TGTTAGAAGGTGAATGAGGTGGG - Intergenic
1076128005 10:127991555-127991577 TTTTGAAAGCTGAATGAGACAGG - Intronic
1078303804 11:10161687-10161709 TTTTAAAAGGAGGAAGAGGGTGG + Intronic
1079532013 11:21465605-21465627 TTTAAAAAGGTGAATGAATGAGG - Intronic
1079963397 11:26951207-26951229 TATTAAAAGCTGAATACTGGTGG - Intergenic
1080319472 11:30989781-30989803 TTTTAAAAGATGAATGCTGTGGG + Intronic
1080685201 11:34509599-34509621 TTTTATATCCTGAGTGAGGGGGG + Intronic
1081146937 11:39572874-39572896 TTTTAAAAGCAGAATAAGCTTGG + Intergenic
1081253078 11:40859778-40859800 TATTAAAATGTGAATGAGGCCGG + Intronic
1081326827 11:41754973-41754995 TTTAATAAAATGAATGAGGGAGG - Intergenic
1081837557 11:46168905-46168927 TTTTAAAAGTTTAATGAGGAGGG + Intergenic
1082123882 11:48409598-48409620 TTTTAAAGGCAGAATAAGAGAGG + Intergenic
1082557559 11:54580857-54580879 TTTTAAAGGCAGAATAAGAGAGG + Intergenic
1083113465 11:60435400-60435422 TTTTAAGAAATAAATGAGGGGGG + Intronic
1083707772 11:64528466-64528488 ATTTAAAAGCTCAAGGAAGGTGG + Intergenic
1084100042 11:66941790-66941812 TTTTTAAGGCTGAATGATGGGGG - Intronic
1086992611 11:93321223-93321245 TTTTAATAGCTAAATGAGTATGG - Intergenic
1087321572 11:96666598-96666620 TTTTACTAGATGATTGAGGGTGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087951405 11:104224695-104224717 TTTTAAAACATGAATAATGGTGG + Intergenic
1088258782 11:107925907-107925929 TTTGAAAAGGAGAATGATGGAGG + Intronic
1088452767 11:109999495-109999517 TTTTAATTGCTAAATGATGGAGG - Intergenic
1089413565 11:118267444-118267466 TTTTCAAAGATGAGAGAGGGAGG + Intergenic
1089676409 11:120092983-120093005 TTTTAAAACCTAAATCAGGCCGG - Intergenic
1092001566 12:5036907-5036929 TCTTAAAAGCTAGAAGAGGGAGG + Intergenic
1093076882 12:14768264-14768286 ACTTAAAATGTGAATGAGGGGGG - Intronic
1093205522 12:16244205-16244227 TTCTAAAGGTTTAATGAGGGAGG + Intronic
1094465182 12:30745916-30745938 TTTTAAAAACTGAATGAAATAGG + Intronic
1095830341 12:46578982-46579004 TTTTACAAACAGAATGAGAGAGG - Intergenic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096306057 12:50477026-50477048 TTTTAAAGGCTTAATTTGGGAGG + Exonic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1096686223 12:53290044-53290066 CTTTAACAGCTGAATGAGTCTGG + Intronic
1098465437 12:70781670-70781692 TTTTAAGAGGTGAAAGAGTGAGG + Intronic
1099062611 12:77930972-77930994 TTCTAAAAGCTTCAGGAGGGTGG - Intronic
1099573351 12:84353668-84353690 TTTTATAAGCTGAATGTGATTGG + Intergenic
1100431966 12:94539002-94539024 TGTGAAAAGCTGAGTGTGGGAGG - Intergenic
1100504962 12:95210583-95210605 TTTTCAAAGCTGGATGGGGAAGG + Exonic
1100635558 12:96431689-96431711 TATTAAAAGCTGAAAGAGCCAGG + Intergenic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1102762522 12:115400788-115400810 TGTTAAAAGCTGGATGAGGCTGG + Intergenic
1103619697 12:122179399-122179421 TGTCAAAAGCTGAATCAGGCCGG - Intronic
1103647954 12:122409826-122409848 TTTTAAAATCCAAATGAGGCCGG - Intronic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1104161220 12:126182617-126182639 TTTTAAAAGCAGAATAAGGCTGG - Intergenic
1104639479 12:130458270-130458292 TTTAAAAAGCTGAATGGGCTTGG + Intronic
1105789009 13:23779454-23779476 TTTAAAAAGGTGTATGGGGGGGG + Intronic
1106746147 13:32710278-32710300 TTTTAGAAGATGCATGAGTGTGG + Intronic
1108141562 13:47427985-47428007 TTTTAAAAGCCCAAAGATGGTGG + Intergenic
1108935187 13:55873790-55873812 TGTGAACAGCTGAATGGGGGTGG - Intergenic
1109315642 13:60745843-60745865 TTTGAAAAACTGAATGATGGTGG + Intergenic
1110056571 13:70981560-70981582 TTTTGAAAGCCCAAGGAGGGAGG - Intergenic
1110111782 13:71756430-71756452 TTTAAAAGGATAAATGAGGGTGG - Intronic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1111188110 13:84770335-84770357 TTTTAATAGCTAAATGAAGATGG - Intergenic
1111834616 13:93372654-93372676 TTTTAAAAAGTGAACGGGGGAGG - Intronic
1111961635 13:94816912-94816934 TTTTAAAAGCTGAAGGAGAAAGG - Intergenic
1114446141 14:22789742-22789764 TTCTTAAAGATGAAAGAGGGAGG + Intronic
1114480059 14:23027504-23027526 TTTTAAAAGCTAGCTGAGTGTGG + Intronic
1114795309 14:25708507-25708529 TCTTTAAATGTGAATGAGGGAGG - Intergenic
1114862672 14:26544525-26544547 TTTAAAAACCTGAATAAGGAAGG - Intronic
1115498437 14:34028667-34028689 TTTTAAAGGCAGAATGGGAGAGG - Intronic
1115901926 14:38161443-38161465 TTTTAAAAACTGGATGAAGGGGG - Intergenic
1115907279 14:38213901-38213923 TTTTAAAAGCTGCAGCAAGGTGG + Intergenic
1117019789 14:51558170-51558192 TTTTAAAAATTAAATGAGGCCGG + Intronic
1117514080 14:56482944-56482966 TTTTAAAAGGGGAGAGAGGGAGG - Intergenic
1117645545 14:57848239-57848261 AGTCAAATGCTGAATGAGGGTGG - Intronic
1117702982 14:58433717-58433739 TTATAAAAGCTGAAGGAAGCTGG + Intronic
1118814183 14:69298327-69298349 ATCTACAAGCTGAAGGAGGGAGG - Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1120628118 14:86854755-86854777 TTTTAAAAGCTGAGAAAGGCAGG + Intergenic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1121077953 14:91084924-91084946 TTTTCAAAGTTAAAAGAGGGTGG + Intronic
1121283956 14:92720107-92720129 TTTTGAAGGCTGAATGGGTGAGG + Intronic
1121951747 14:98176958-98176980 TTTTAGAAAATGAATGAGGTGGG - Intergenic
1124694740 15:31854573-31854595 TCTTAAAAGTGGAAGGAGGGAGG - Intronic
1125112611 15:36050955-36050977 TTTTAAAAACTGCTTGAGGGTGG + Intergenic
1125839786 15:42789435-42789457 TTTTAAAAGCTGAATAAGGTCGG + Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126349151 15:47726642-47726664 TTATAAAAGGTGGATGATGGTGG + Intronic
1126358344 15:47819676-47819698 TTTGAAAATCTGAAGGCGGGGGG + Intergenic
1127405750 15:58644071-58644093 TTTTAAAATTTGAATGTGGCAGG - Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1128271565 15:66314803-66314825 TTTTGAAAGATGATTGAGGGTGG + Intronic
1128651628 15:69419407-69419429 TACTAAAAGATGAATGAAGGTGG - Intronic
1130001487 15:80051457-80051479 TTTTAAAAGCTGAACAAATGAGG + Intergenic
1130353545 15:83110841-83110863 TTTTTAAAAAAGAATGAGGGTGG - Intronic
1130763452 15:86845268-86845290 TTTTAATACATGAATAAGGGTGG + Intronic
1133460556 16:5983292-5983314 TTTTAAAAGCTTAGTGGGTGGGG + Intergenic
1134828106 16:17300753-17300775 TTTTAATAGCTGCATTAGGCTGG - Intronic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137509582 16:49087238-49087260 TTATAAAATGTGAATGAAGGAGG + Intergenic
1137814943 16:51389608-51389630 TTTCAACATATGAATGAGGGAGG + Intergenic
1137930025 16:52578239-52578261 TTGGAAAAGCTGAAAGAGAGGGG - Intergenic
1138523393 16:57586546-57586568 TTTTAAAAGTTGATAGAGGCCGG + Intronic
1139609764 16:68047352-68047374 TATTAAAATCAGAATGAGAGAGG - Intronic
1141238194 16:82240205-82240227 TGTGAAAAGCTGATTGGGGGTGG + Intergenic
1141789259 16:86222933-86222955 TTTTAAAAGCAGAGATAGGGAGG - Intergenic
1141906598 16:87030813-87030835 TTATAAAAGCGGCCTGAGGGAGG - Intergenic
1141985598 16:87577628-87577650 TTTTAAAAGCTGAGGAGGGGTGG - Intergenic
1142809920 17:2390902-2390924 TGTTAAAGCCAGAATGAGGGAGG - Intronic
1144363850 17:14522969-14522991 TTCTAAAAGCTGGATTAGGGAGG - Intergenic
1144378459 17:14669021-14669043 TTTTCAAAGCTTTATGAGGTAGG + Intergenic
1145860950 17:28209462-28209484 TTTTAATAGCTGAATGAACTGGG - Intergenic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146961921 17:36988014-36988036 TTTTAAAAGTTACATGAGGCTGG + Intronic
1149924554 17:60690271-60690293 TTTTAAAGGCTGAATGAGGCAGG + Intronic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1151058907 17:71067979-71068001 TTTTAAAAAATGAATTAGGTTGG + Intergenic
1151817943 17:76480681-76480703 TTTTAAATTCAGAATGAGGCTGG - Intronic
1152050917 17:77976297-77976319 TTTTATAAGGTGGGTGAGGGAGG + Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152599657 17:81255682-81255704 TTTTTGAAGCCAAATGAGGGAGG - Intronic
1153620372 18:6971933-6971955 TTTTAAAGGCTGCTTGGGGGAGG - Exonic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1156215010 18:34989175-34989197 TTGTAATAGTTGCATGAGGGTGG - Intronic
1156338947 18:36193558-36193580 TTTTGAATGCAGAATGAGGTAGG - Intronic
1156499705 18:37549998-37550020 TTTTAACAGCTGAAGCTGGGAGG + Intronic
1157256833 18:46147027-46147049 TTTTAAAGGCAGAATGACAGAGG - Intergenic
1157665038 18:49479024-49479046 TTTTAAAAGCAGGATAGGGGTGG - Intronic
1158179451 18:54697528-54697550 TTTAAAATGGTAAATGAGGGAGG - Intergenic
1159082927 18:63755535-63755557 TTTTAAAAGGTGAATTAGTGAGG + Intronic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159553651 18:69922769-69922791 ACTTGAAAGCTGTATGAGGGTGG - Intronic
1160614339 18:80112745-80112767 TTTTAAAAGCAGAGTGATTGGGG - Intronic
1161309106 19:3584301-3584323 TTTAAAAAACTGAATGCGGCCGG + Intergenic
1161909824 19:7184869-7184891 GTTTAACAGCTGCCTGAGGGAGG + Intronic
1162357937 19:10198332-10198354 TTTTAAAGACTGAATTAGGCTGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163526961 19:17827267-17827289 GTTTTAAAACTGAATGAGTGCGG - Intronic
1167259067 19:48447675-48447697 TTCTAAAAACTGAAGGAGGCCGG - Intronic
1167350868 19:48973811-48973833 TTTTTAAAGCTAAATAAGGCTGG - Intronic
925661067 2:6203275-6203297 TTATAAAAGATAAATGAGGTAGG + Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
927549523 2:23985693-23985715 TTTTAAACATTGAATGAGGTAGG + Intronic
928035128 2:27815685-27815707 TCTTAGAAGCTTAAGGAGGGTGG + Intronic
928361503 2:30665738-30665760 TTGTAAAAGCAGGATGATGGGGG - Intergenic
928402549 2:30989741-30989763 TTATAAAAACTGAATTAGGTAGG + Intronic
929692706 2:44087647-44087669 TTTTGGAGCCTGAATGAGGGTGG + Intergenic
930698634 2:54436967-54436989 TTTAAAAATCTGACTGAGTGCGG - Intergenic
931235975 2:60412973-60412995 TTTTAAAAGCAGACAGAGGTAGG + Intergenic
931718894 2:65052904-65052926 TTTTAAAAGATGACTGAGGATGG + Intergenic
932459568 2:71873506-71873528 TTTTAAAACCTGCATGGGCGTGG - Intergenic
932611298 2:73202402-73202424 TTTTAAAAGCGGAGGAAGGGAGG + Exonic
934962113 2:98685322-98685344 TTTTTAAATATGAATGAGGAAGG + Intronic
934987120 2:98895563-98895585 TTTTGAGAGCTGGATTAGGGTGG + Intronic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
936918677 2:117665395-117665417 TTTTGAAAGCTAAATAAGGTTGG + Intergenic
937006022 2:118515748-118515770 TTTTAAAAGCATAATTAGGCCGG + Intergenic
937020247 2:118644011-118644033 TTTTTCAATTTGAATGAGGGGGG + Intergenic
937447136 2:121967981-121968003 TCTAAAAAGCTGAATCAGGCTGG - Intergenic
938851767 2:135267811-135267833 TTTTAACATCTGAATTTGGGGGG - Intronic
938980232 2:136519398-136519420 TTTTGCTAGCTGAATGCGGGAGG + Intergenic
939566633 2:143793300-143793322 TTTTAAAAGAAGATTGAGGGCGG - Intergenic
940038450 2:149333566-149333588 TTTTAAAAACTGCATGAGGTAGG - Intronic
943643209 2:190381529-190381551 TTTTTAATGCTCAAAGAGGGGGG - Intergenic
943917744 2:193658938-193658960 TTTTAAAAGCTGAAAGACCTGGG + Intergenic
944089869 2:195894496-195894518 TTTGAAATGCTGAAGGAGTGGGG - Intronic
945204158 2:207313983-207314005 TTATAAAAGCAGACTGATGGAGG - Intergenic
945267859 2:207908938-207908960 TCTTCACAGCAGAATGAGGGTGG + Intronic
945326878 2:208492416-208492438 TTTTAAAGGGAGAATGAGGGAGG + Intronic
945654067 2:212602280-212602302 TTTAAATGGCTGAATGAGGATGG + Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946167720 2:217875646-217875668 TTTTGAAAGAGGAAAGAGGGAGG - Intronic
946442559 2:219709101-219709123 TTCTAAAAACTAAATGAGGCTGG - Intergenic
946940704 2:224767458-224767480 TTTTAAAAACTACATGAGGCCGG - Intronic
946963622 2:225012095-225012117 TTTCAAATTCTGAATGAGTGGGG - Intronic
947235737 2:227938961-227938983 TTTTCAAAGCTCAGTGAGTGAGG + Intergenic
948514164 2:238493076-238493098 TTTTTAAAGCTTCTTGAGGGTGG + Intergenic
1170618507 20:17974375-17974397 TTTTAAAATGTGTATGAGGAGGG + Intronic
1171309754 20:24136541-24136563 TTTAAAAAGTTGAGTGTGGGTGG + Intergenic
1172382954 20:34512108-34512130 TATTAAAAGCTGAAAGAGTGAGG - Intergenic
1172406200 20:34691333-34691355 TTTTAAAAGTTGACTTAGGCTGG - Intergenic
1174124056 20:48289668-48289690 TCCTTAAAGGTGAATGAGGGAGG + Intergenic
1174222234 20:48965564-48965586 TTTTCAAAAGTGAATGGGGGTGG + Intronic
1174842052 20:53910232-53910254 TTTTAAAAGCAAAAAGAGGCCGG - Intergenic
1175406890 20:58740798-58740820 TCTTAAAAGTTGGAGGAGGGTGG + Intergenic
1175527177 20:59643204-59643226 TTTTAAAAGAAGAATTAGGCCGG - Intronic
1175990891 20:62788484-62788506 CTTTAGAAGCTGAATGAATGGGG + Intergenic
1177014690 21:15771543-15771565 TTGTTGAAGCTGAATGAGCGAGG + Intronic
1177361530 21:20078617-20078639 CTTCAAAAGTTGAATGAGGCCGG + Intergenic
1179283401 21:39954128-39954150 TACTAAAAGCTGAAAGAGGTTGG - Intergenic
1185389733 22:50552720-50552742 TTTCAACAGGTGAATGTGGGAGG - Intronic
949210519 3:1493607-1493629 TTGTAAAAGCTAATTGAAGGAGG + Intergenic
949416156 3:3816466-3816488 TTCTAAAAGTGGACTGAGGGTGG - Intronic
949521150 3:4855182-4855204 TTATAAGAGTTGAAAGAGGGAGG - Intronic
949571929 3:5301863-5301885 TTTAGAAGGCTTAATGAGGGGGG + Intergenic
949691304 3:6643025-6643047 TTTTAACATATGAATGTGGGAGG + Intergenic
952923357 3:38303890-38303912 TTTTAAAAGTTCAATCAGGCCGG + Intronic
953055788 3:39386282-39386304 TTTTAAAAGATGACTCAGGCGGG + Intronic
953142048 3:40238167-40238189 TTTAAAAAGCTGAAGGATGGGGG - Intronic
953231448 3:41068748-41068770 AGATAAAAGCTGAATCAGGGTGG - Intergenic
954010476 3:47632432-47632454 TTTTAAAAGTTTCATGAGGCTGG - Intronic
954598394 3:51847490-51847512 TTTTAAAGGGAGAATGAGGGAGG + Intergenic
955746787 3:62148461-62148483 TTTAAAAAGCTAAAAGAGGCTGG + Intronic
955867089 3:63396603-63396625 TTTGAAAAGATGTATGATGGAGG + Intronic
956516551 3:70055210-70055232 TTATCAAAGCTGGATGATGGAGG + Intergenic
956814597 3:72896546-72896568 CATTAAAAGCTGAAGGAGTGTGG + Intronic
957119941 3:76077264-76077286 TTTTAAAATCTTAATGAGGCCGG + Intronic
957718665 3:83967029-83967051 TTTTAATACCTTCATGAGGGAGG + Intergenic
957758773 3:84527084-84527106 TTTATAAAGCTGAATGAAGAGGG + Intergenic
957766909 3:84637223-84637245 TTTTAAATTATGAATGAGGTGGG + Intergenic
957862196 3:85968347-85968369 TTTTAAAAGGTGTATGTGTGTGG + Intronic
958542969 3:95503255-95503277 TTTCAAAAGCAGTATTAGGGAGG - Intergenic
959146769 3:102556337-102556359 TTTTAAAAGCTGTCTCAGAGAGG + Intergenic
959491955 3:107001039-107001061 CTTTAAAACCTGAAGGATGGAGG + Intergenic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
959945415 3:112120579-112120601 TTTTAAGACCAGCATGAGGGAGG + Intronic
960661122 3:120060125-120060147 TCTTAAAATCGGAAAGAGGGAGG + Intronic
961699146 3:128728167-128728189 TTTTAAAAGGTGAATGATCTTGG + Intronic
962107944 3:132413046-132413068 TTTTCAAAGATGGATGAGGAGGG - Intergenic
962137255 3:132747778-132747800 TTTAAAATGCTGAAAGAGGCTGG - Intergenic
962240880 3:133749858-133749880 TTTTAAAGGGAGAATGAGGGAGG + Intronic
962859326 3:139384479-139384501 TTTAAAAACCTGAAAGAGGTTGG - Intronic
962925779 3:139992159-139992181 TTTTAACAGATGGATGAGTGTGG + Intronic
963926358 3:150955536-150955558 TTTTAGAAGTTGAAAGAGGCAGG + Intronic
964143372 3:153429604-153429626 TCTTAAAACCTCAATGAGGTAGG + Intergenic
965188497 3:165498671-165498693 TTGTAAAAGCTGGTTTAGGGAGG - Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
966768796 3:183485757-183485779 TTTTAAAGGGAGAATAAGGGAGG - Intergenic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967707933 3:192673962-192673984 TTTGAAAAGCTGTCTGAGTGTGG - Intronic
968178286 3:196569542-196569564 TGTCAAAAGTTGAATGAGTGAGG - Intronic
968875779 4:3267210-3267232 TTTAAAAAGGTGAAAGAGGCCGG + Intronic
969187371 4:5486429-5486451 TTGTAAAAGCAGTATTAGGGTGG + Intronic
970504482 4:16713591-16713613 TTTTAAAAGCTTTATTAGGTTGG + Intronic
970590130 4:17552819-17552841 TTTTAAAAACTAAATGGGGCTGG + Intergenic
971144619 4:23963133-23963155 TTTTAGAAGCTGATTGATTGTGG - Intergenic
971685082 4:29755303-29755325 TTTTAAAAGATGACTAAGAGGGG + Intergenic
972215037 4:36888072-36888094 TTTTAATAGCTGAATGACTGTGG + Intergenic
972412051 4:38805195-38805217 TATTAAAAGTGGAAAGAGGGAGG + Intronic
972586677 4:40443900-40443922 TATTAAAAGATAAATGAGGCTGG + Intronic
972796966 4:42430789-42430811 TGGTGGAAGCTGAATGAGGGAGG - Intronic
973017462 4:45159117-45159139 TTTTAAAAGCTGAATAATATTGG + Intergenic
974419042 4:61647297-61647319 TTTTAAAAGTTAAATCGGGGAGG - Intronic
975540751 4:75509126-75509148 TTTTAAAAGCTGTATTAAGGTGG - Intronic
976073540 4:81271001-81271023 TATTAAAAGCTGAAAGAGCCAGG - Intergenic
976145705 4:82041160-82041182 ATTTAAGAGCTCCATGAGGGAGG + Intronic
978182248 4:105813168-105813190 TTGTAACAGCTCAATGAGGTTGG - Intronic
979559670 4:122088047-122088069 TTTTAATAGCTGAAGGGGAGGGG - Intergenic
979779310 4:124630018-124630040 TTCTAAAAGCTGAATTATGTAGG + Intergenic
980619194 4:135275649-135275671 TTTTAAAACTTGAATTAGTGTGG + Intergenic
981637862 4:146900672-146900694 TTTAAAAATCAGAATGAGAGGGG + Intronic
982631204 4:157831633-157831655 TTTTATAATCTGAATCAGTGAGG - Intergenic
983310816 4:166058667-166058689 TTTTAAAAGAGGAATAAAGGAGG - Intronic
983407803 4:167352364-167352386 TTTTAAAAGATATATGTGGGAGG - Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984119269 4:175722377-175722399 TTATAAAAGTTGAAAGAGGCTGG - Intronic
984956846 4:185053617-185053639 TTTTAAAAGCTGGCTGGGGTCGG - Intergenic
985835530 5:2269394-2269416 TTTTAAAGGCAGGATGATGGTGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986016820 5:3764493-3764515 TTTTAAAACTTAAATGAGGAAGG - Intergenic
986831363 5:11582583-11582605 TTTTGAAAGCTGAATGCTGACGG - Intronic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989219586 5:38941976-38941998 TTTTAAAAGCATAATGACAGTGG - Exonic
989727030 5:44598762-44598784 TTTTAAAAAATGAATTATGGTGG + Intergenic
989961929 5:50426314-50426336 TTATAACAGCTCAATGAGGTGGG - Intronic
990279165 5:54231356-54231378 TGTTATAGGCTGGATGAGGGTGG - Intronic
990938246 5:61173395-61173417 ATTTAAAACCTGAAGGATGGAGG + Intergenic
991306494 5:65181880-65181902 TTTTAAAATGTGAAGGAGGCAGG - Intronic
992561797 5:77959392-77959414 TTTTAAAAGGTGGAAGAGGAGGG - Intergenic
993076969 5:83244361-83244383 TTTTGTAAGCTCAATTAGGGTGG + Intronic
994304999 5:98192327-98192349 TTTTAACATATGAGTGAGGGGGG + Intergenic
994686891 5:102966952-102966974 TTGTAAAATCTTAATGAGGCAGG - Intronic
994999580 5:107110352-107110374 TCTTAAAAGCTGCAGGAGGAGGG + Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995399441 5:111723551-111723573 TTTTAAAAATGGAATGATGGTGG - Intronic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995612140 5:113922126-113922148 TTTTAAAAGCCAAATGTGGCCGG - Intergenic
995636136 5:114193160-114193182 TTTGAAGAGCTGGATGAAGGGGG - Intergenic
995762151 5:115574956-115574978 GATTAAAAGCTCAATGAGGCTGG - Intergenic
996075821 5:119192458-119192480 TTTGAAAAGCTGAATGTGAGTGG - Intronic
996179048 5:120396309-120396331 TATTAAAAGCTGAGAGAGGTAGG + Intergenic
996376678 5:122816801-122816823 TTTTAAAATTTGTATGTGGGGGG + Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997914456 5:137910475-137910497 TTTTAAAAGCTGGATGGGCCGGG + Intronic
1000374236 5:160564612-160564634 TTCTAAGAGCTGAATGAGGATGG + Exonic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1000928098 5:167218329-167218351 ATTTAAAAGCTTTATGAGAGCGG + Intergenic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002598689 5:180340924-180340946 TTTCAACAGATGAATGACGGGGG + Intronic
1002682405 5:180977099-180977121 TTGAAAAAGCTGAATTAGGTAGG + Intergenic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1003453132 6:6255840-6255862 TTTAAAAAGAAGATTGAGGGTGG + Intronic
1003581680 6:7346256-7346278 TTTTAAAAAGTAAATCAGGGCGG + Intronic
1003621429 6:7704507-7704529 TTTCAACAGATGAATTAGGGAGG - Intergenic
1004221410 6:13750429-13750451 TTTAAAAAGAAGAATGAAGGTGG - Intergenic
1004439057 6:15629728-15629750 TTTTAAAATCTGTATAATGGAGG - Intronic
1004835769 6:19529816-19529838 GTTTAGAAGCTGAATGGGTGGGG + Intergenic
1006057821 6:31398710-31398732 TTTTAAAAGGTTAAGGAGGCTGG - Intergenic
1006070254 6:31493240-31493262 TTTTAAAAGGTTAAGGAGGCTGG - Intergenic
1006486300 6:34345361-34345383 TTTTAAAAGCTGAAGGGAGTCGG + Intronic
1007894674 6:45341450-45341472 TTTTAAAAGCTACATGAGGTAGG + Intronic
1008041493 6:46805980-46806002 TTTTAAAAGCTGACTGGCGATGG - Intronic
1008942130 6:57058088-57058110 TTTTAAAAGCTGCATGAGATGGG - Intergenic
1010047599 6:71464736-71464758 TTGTAAGAGTTAAATGAGGGAGG - Intergenic
1010577490 6:77550618-77550640 TTTTAATTTCTGAAGGAGGGTGG - Intergenic
1010658819 6:78544728-78544750 TTTTAAAAGCATAATGGTGGAGG + Intergenic
1011172483 6:84521511-84521533 TTTAAAAGGCTGAAAGAGGGAGG + Intergenic
1012576169 6:100802701-100802723 TATTAAAAGCAGAATCAGGCTGG + Intronic
1012877837 6:104750353-104750375 ATCAAAAAGCTGTATGAGGGAGG + Exonic
1012945946 6:105465793-105465815 TTCCCAAAGCTGAATGAGGCTGG - Intergenic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1014445054 6:121517304-121517326 TTGTGAAAGCTGATTGAGAGAGG - Intergenic
1015004229 6:128258859-128258881 ATCAGAAAGCTGAATGAGGGAGG + Intronic
1015040605 6:128713604-128713626 TTTTAAAAGCTGAAAATGGTAGG + Intergenic
1015657144 6:135531781-135531803 TTTTAATAGGTGAATGAATGGGG - Intergenic
1015971789 6:138749720-138749742 TTTTAAAAGCTGAACACGGGGGG + Intergenic
1016720724 6:147294369-147294391 TTTTAACAACTCAATGAGGTAGG - Intronic
1016890489 6:149001697-149001719 TATTAAAAGATGAATTATGGGGG + Intronic
1017815376 6:158012374-158012396 CCTTAAAAGCTGGAAGAGGGAGG + Intronic
1018197843 6:161370286-161370308 TTTTAAAAGCTGAATTAGGCTGG + Intronic
1018333722 6:162761640-162761662 TTTCAAAACCTGAGTGAGGCTGG + Intronic
1019375564 7:689993-690015 TTTAAAGAGCTGAGGGAGGGAGG + Intronic
1020378551 7:7515582-7515604 TTTGCAAAGCTGAAGGAGGCTGG + Intronic
1020475836 7:8593329-8593351 TTTAAAAAGCTAAATTAGGTGGG - Intronic
1020520527 7:9180416-9180438 TTTTAAGATGTGGATGAGGGAGG + Intergenic
1020840913 7:13216379-13216401 TTTTAAAAGTGGACTCAGGGAGG + Intergenic
1021833617 7:24644454-24644476 TTTCAAAAGATCAATGAGGTTGG - Intronic
1023705122 7:42932885-42932907 TTTTAAAGGGAGAATGAGCGAGG + Intronic
1023813825 7:43932871-43932893 TTTTAAAAACTGAATTTTGGGGG - Intronic
1024622927 7:51178382-51178404 TGGTCAAAGCTGAATGAGGTTGG + Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1028123242 7:87081643-87081665 TGTGAAAAGCAGAATGAGAGAGG + Intergenic
1028726452 7:94092982-94093004 TTTTCAAGGCTGAATGAAGCAGG - Intergenic
1031068876 7:117139961-117139983 GTTTAAAAGCTGAATGTGGCTGG - Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032137188 7:129290632-129290654 TTTTAAAAAGTGAATGTGGCCGG + Intronic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1032750629 7:134836859-134836881 TGTTAATAGAAGAATGAGGGTGG - Intronic
1033956862 7:146860235-146860257 TTTTAAAAAGTGGTTGAGGGTGG + Intronic
1034346105 7:150386230-150386252 TTTTAAAAGTTAAATAAGGCTGG - Intronic
1034963238 7:155375032-155375054 TTTGAAAGGCGGACTGAGGGTGG - Intergenic
1036171122 8:6486019-6486041 ATTTAAAAGTTAAAGGAGGGGGG - Intronic
1036283873 8:7426244-7426266 TTTTAAAAGCAGCCTGAGGGCGG - Intergenic
1036337602 8:7885286-7885308 TTTTAAAAGCAGCCTGAGGGCGG + Intergenic
1038682051 8:29677845-29677867 TTTTATAAGCTTCATGAGGCAGG - Intergenic
1038767712 8:30444190-30444212 TTTTACAATCTGAAAGAGGCAGG - Intronic
1038994893 8:32910927-32910949 TTTTAAAAAATGAATGAGAGGGG + Intergenic
1041157233 8:55000836-55000858 TTTTAAAAACTGATGGAGAGAGG + Intergenic
1041585120 8:59507572-59507594 TTTTAAAAGCTCTATGAAGCTGG - Intergenic
1041905826 8:63032330-63032352 TTTTAAAACATGAATCAGGCTGG - Intronic
1041907329 8:63048332-63048354 TTTTAAAAAATCAATGAGGCAGG + Intergenic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1043038511 8:75229526-75229548 TTTTGAAAGCTGAATGGTGATGG - Intergenic
1043054934 8:75425378-75425400 TTTTAAAAGCTGCATTGGGCTGG - Intronic
1044235238 8:89822986-89823008 TCTTAAAATCTGAAAGAGGCTGG - Intergenic
1044608683 8:94070815-94070837 TTTTAAAAGATGAATCAAGATGG - Intergenic
1044848124 8:96401627-96401649 TTTTAAAAGATGATGCAGGGTGG + Intergenic
1044980695 8:97713379-97713401 TTTTAAAAACTCACTGAGGCTGG - Intronic
1046597514 8:116278384-116278406 ATTTAAAAGATTAATGAAGGTGG + Intergenic
1047129132 8:121999197-121999219 TTTTGAAAGATGGATAAGGGAGG + Intergenic
1047175590 8:122537648-122537670 CTTGGAAAGGTGAATGAGGGAGG + Intergenic
1047208315 8:122820689-122820711 TTTTATAAGCTGAATAAGAATGG + Intronic
1047360315 8:124162978-124163000 TTGTAAAGCCTGCATGAGGGAGG + Intergenic
1047561526 8:125992072-125992094 TATGAACAGCTGAATGGGGGTGG + Intergenic
1047650371 8:126913914-126913936 TTTTAAAATCAGATTGAGGTTGG - Intergenic
1047737770 8:127781449-127781471 TTTTAGAAGCTAAATCAGGCTGG - Intergenic
1047855798 8:128910358-128910380 TTTTAAAAGCAGCAAGAGAGAGG + Intergenic
1050042055 9:1506363-1506385 TTTTAAAAGGAGAGGGAGGGAGG - Intergenic
1050208677 9:3228064-3228086 TTTTAAAAGGTGGCGGAGGGTGG - Intronic
1051091125 9:13409571-13409593 TTTTAAGAGTTGAAATAGGGAGG - Intergenic
1051268942 9:15336077-15336099 TTTTAAAAACCAAATGAGGCTGG + Intergenic
1051671705 9:19517078-19517100 TTTTAAAAGGTGAATGAAAAGGG - Intronic
1052751080 9:32491541-32491563 TTTTAAAAGGTGAAGGGGAGTGG - Intronic
1052755792 9:32539343-32539365 ATTTGGCAGCTGAATGAGGGGGG + Intergenic
1053239054 9:36481624-36481646 TTTTTAAACATGATTGAGGGTGG - Intronic
1053556809 9:39145855-39145877 TTTTAAAAATGGTATGAGGGTGG - Intronic
1053820919 9:41966133-41966155 TTTTAAAAATGGTATGAGGGTGG - Intronic
1054089789 9:60834272-60834294 TTTTAAAAATGGTATGAGGGTGG - Intergenic
1054111200 9:61109830-61109852 TTTTAAAAATGGTATGAGGGTGG - Intergenic
1054609657 9:67221295-67221317 TTTTAAAAATGGTATGAGGGTGG + Intergenic
1054798296 9:69323544-69323566 TTTTAAAAACTGCATGAAGCCGG + Intergenic
1055179424 9:73365761-73365783 TTTTAAAAGGAGAATTAAGGAGG - Intergenic
1055460905 9:76519391-76519413 TTCTAGAAACTGCATGAGGGAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055919899 9:81449324-81449346 TTTAAAAAATTGAATGTGGGAGG - Intergenic
1056844632 9:90026523-90026545 TTTTAAAAGGGAAATGTGGGTGG + Intergenic
1057489817 9:95511828-95511850 TTTTAAAAACTGGGGGAGGGGGG + Intronic
1058381359 9:104380352-104380374 ATTTAATAGCTGAGGGAGGGTGG - Intergenic
1059060911 9:111034897-111034919 TTTTAAAAGATGAATGGTGGGGG - Intronic
1059553789 9:115257719-115257741 TGCCAAAAGCTGAAGGAGGGTGG + Intronic
1059646822 9:116276215-116276237 TGATAAAAGCTGAAGGAGGTGGG + Intronic
1061694697 9:132364031-132364053 ATTTAAAAGCTGTATTAGGCCGG - Intergenic
1061774912 9:132955586-132955608 TTTAAAAAGCTGAAAGAGGCTGG - Intronic
1062143049 9:134970727-134970749 TATTAAAAGCAGATTGATGGAGG - Intergenic
1062351137 9:136139348-136139370 TTTTAAAAGCTGTTTGTGGCTGG - Intergenic
1062588262 9:137260762-137260784 TTTAAAAAGCTAAATTAGGCCGG + Intronic
1062656885 9:137608290-137608312 TTTTTAAACCTGCATGGGGGAGG + Intronic
1186040300 X:5469510-5469532 ATTTTAAAGCTAAATGAGAGTGG - Intergenic
1187054178 X:15726031-15726053 TTTTAAAAGAGAAAAGAGGGTGG - Intronic
1187170289 X:16844618-16844640 TTTTAAAAGCTTAGTGGGGGGGG - Intronic
1187469008 X:19551875-19551897 TTTAAAAAGATGAATTGGGGGGG - Intronic
1187491206 X:19753155-19753177 TTTGAAGAGCTGAGTGAGGTTGG + Intronic
1188138810 X:26523120-26523142 TTTCAAGAGCTGCCTGAGGGTGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1190066302 X:47243980-47244002 TTTTGAATGCAAAATGAGGGGGG - Intronic
1190161141 X:48032257-48032279 TTTTAAAAGCCCACTGTGGGTGG - Intronic
1190161716 X:48036588-48036610 TTTGAAAAGTTGAATAAGGCTGG + Intronic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1190913329 X:54791272-54791294 TTTAGGAGGCTGAATGAGGGAGG - Intronic
1190969169 X:55332297-55332319 TTTTATTAGCTGCATGATGGTGG - Intergenic
1192584753 X:72310062-72310084 TTTTAAAACCAGACTGAGAGGGG + Intergenic
1193212555 X:78824521-78824543 TTTGAAAAGCTGAATGTTGCAGG - Intergenic
1194135369 X:90134139-90134161 TTTTCAAGGGAGAATGAGGGAGG - Intergenic
1194194831 X:90880335-90880357 TTTTAATATCAGAATGATGGTGG + Intergenic
1194489977 X:94533854-94533876 TTTTAAAAACTCAATGAGCTTGG + Intergenic
1194909554 X:99624163-99624185 TTAGAAAACCTGCATGAGGGTGG - Intergenic
1196116014 X:112000295-112000317 TTTTATAAGCTCACTGAGGTTGG - Intronic
1196264619 X:113627594-113627616 TTTTAAAAGCAGTCAGAGGGAGG - Intergenic
1196340653 X:114592265-114592287 TTTTAAATTCTGAATTAGGTTGG - Intronic
1198003821 X:132470597-132470619 TTTTAAAAGTTGTATTATGGTGG - Intronic
1198009455 X:132536064-132536086 TTTTAAAAGCAGAAGTAGGCCGG + Intergenic
1198249302 X:134864319-134864341 TTTTAAAAGCTGCATAAGGCCGG - Intergenic
1198493943 X:137171493-137171515 TTTTCTCAGCTGAATGTGGGGGG + Intergenic
1199099567 X:143782887-143782909 TTCTAAAATCTGAATGGTGGAGG + Intergenic
1199807234 X:151312372-151312394 TGGTAAATGCTGAATGAGTGAGG + Intergenic
1201349808 Y:13027356-13027378 TTTTAAAACTTTATTGAGGGAGG - Intergenic