ID: 997373565

View in Genome Browser
Species Human (GRCh38)
Location 5:133380978-133381000
Sequence GCTTTTTCTGCAACTACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997373565_997373567 -8 Left 997373565 5:133380978-133381000 CCCTCAGTAGTTGCAGAAAAAGC 0: 1
1: 0
2: 3
3: 24
4: 177
Right 997373567 5:133380993-133381015 GAAAAAGCATTTTGTCAAAAAGG 0: 1
1: 2
2: 5
3: 37
4: 594
997373565_997373568 -7 Left 997373565 5:133380978-133381000 CCCTCAGTAGTTGCAGAAAAAGC 0: 1
1: 0
2: 3
3: 24
4: 177
Right 997373568 5:133380994-133381016 AAAAAGCATTTTGTCAAAAAGGG 0: 1
1: 0
2: 5
3: 60
4: 867
997373565_997373569 -6 Left 997373565 5:133380978-133381000 CCCTCAGTAGTTGCAGAAAAAGC 0: 1
1: 0
2: 3
3: 24
4: 177
Right 997373569 5:133380995-133381017 AAAAGCATTTTGTCAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997373565 Original CRISPR GCTTTTTCTGCAACTACTGA GGG (reversed) Intronic
900584758 1:3427475-3427497 GCTTCTTCTTCACCTACTGGAGG - Intronic
902120634 1:14162394-14162416 ATTTTTGCTGAAACTACTGAGGG + Intergenic
902288860 1:15423879-15423901 GGTTTTTCTGCACCTAAAGAAGG - Intronic
903799939 1:25959327-25959349 GCTGGTTCTGCAAGTGCTGAGGG + Intergenic
906539864 1:46577008-46577030 GCATTTACTGCATCTACTGAAGG + Intronic
907383145 1:54108175-54108197 GCTTTTTCTCCAGCGGCTGAAGG + Intronic
908310453 1:62876440-62876462 GCTTTTTCAGCAATAATTGAAGG + Intergenic
909148270 1:71966486-71966508 GTTTTTTCTATACCTACTGATGG + Intronic
913106807 1:115622395-115622417 GCTTTTTGTCCCACTACTGAGGG + Intergenic
915979810 1:160413212-160413234 GCTTATTCTCAAATTACTGATGG + Intronic
915998406 1:160588931-160588953 GCATTTTCTCCAATTACTTAGGG + Intergenic
916628706 1:166588495-166588517 GTTCTTTCTGCTTCTACTGACGG + Intergenic
923696681 1:236259229-236259251 ATCTTTTCTGCAACTACTAAAGG - Intronic
1064717886 10:18195773-18195795 TCTTCTTCTGCAACAACTCAAGG - Intronic
1067138655 10:43635115-43635137 GCTTTTTCTGCAATTGCTTTTGG + Intergenic
1067931888 10:50570194-50570216 GCTTTTTCTGCAAGTAAGGAAGG - Intronic
1071938943 10:90565572-90565594 GCTTTTTCTGCATCTACGAGAGG + Intergenic
1073845079 10:107545190-107545212 GCTTTTTCTGCGCCTGCTGATGG + Intergenic
1073932683 10:108594329-108594351 GCTTTTTCAGCACATAATGATGG - Intergenic
1074149144 10:110742533-110742555 CCTTTTTCTGGAGCTACTAAAGG + Intronic
1075536085 10:123273477-123273499 GCTTTTCCTCCAACTACCCAAGG - Intergenic
1076144662 10:128107917-128107939 TCTTTCTCTTCACCTACTGATGG + Exonic
1077449773 11:2632803-2632825 TCTTTCTCTGCATCTGCTGATGG + Intronic
1077770428 11:5212395-5212417 GCTTTTGCTGCAATGACTGTTGG + Intergenic
1077926399 11:6685794-6685816 GCTTTCTCTGCAATTTCTGTGGG + Intergenic
1078082166 11:8211902-8211924 CCTTTTCCTTCAACTTCTGATGG - Intergenic
1078684867 11:13519770-13519792 GCTTTTGCTGCAATTACTTTTGG - Intergenic
1081508388 11:43742063-43742085 GCTATCTCTGCTACTACTGTTGG + Intronic
1082189017 11:49219422-49219444 ACTTTTCCTGCTACTCCTGAAGG - Intergenic
1083209382 11:61173487-61173509 GCTTTTTCTGAATCTAACGAAGG - Intergenic
1083772349 11:64875224-64875246 GCTTTTTCTGCGTCCAGTGAAGG - Intronic
1086485497 11:87296558-87296580 GTTTTTACTGCAAATATTGAAGG + Intronic
1086677507 11:89627206-89627228 ACTTTTCCTGCTACTCCTGAAGG + Intergenic
1087234964 11:95707819-95707841 GCTTTTTCTGCAACAGCGGGAGG - Intergenic
1087866536 11:103234663-103234685 GCTTTTTCTGCAACTGCCTTGGG + Intronic
1088287987 11:108207264-108207286 GCTTTTTCTGCACCCACCCATGG - Intronic
1090790050 11:130084260-130084282 GCTTTTTCTGCATCTTTTGAGGG + Intronic
1091100568 11:132869062-132869084 GCTTTTGCTCCAACTGCTCATGG - Intronic
1093771858 12:23027414-23027436 GCTTTTTCTGCAGCCCCAGATGG + Intergenic
1095295366 12:40521464-40521486 CCTTTTTCAGGTACTACTGAGGG + Intronic
1096928821 12:55181264-55181286 GCTTTTGTTGCAATTACTGCTGG + Intergenic
1098457055 12:70686400-70686422 CCTTTTTCTGAAACTAATTATGG - Intronic
1101210815 12:102533750-102533772 GCATTTTCTGCAACTCCTCCAGG - Intergenic
1101285601 12:103308997-103309019 GCTTTTTCTGGAGATTCTGAAGG - Intronic
1101333152 12:103773284-103773306 GCTTTTGCTACTACTACTGTGGG - Exonic
1101458631 12:104864871-104864893 GAGTTTTCTGAAAGTACTGATGG + Intronic
1102018411 12:109663862-109663884 GCTTTTCCTGCACCAAATGATGG + Intergenic
1105703823 13:22956396-22956418 GCTTTTTCTGTGTCTATTGATGG - Intergenic
1105856782 13:24381477-24381499 GCTTTTTCTGTGTCTATTGATGG - Intergenic
1107911161 13:45106881-45106903 GCCTTTTCTGAAACTACCTATGG - Intergenic
1108466723 13:50724141-50724163 GCTTTTTCTTCAATTAGTGATGG - Intronic
1108831960 13:54490504-54490526 GCTTTTTCTGCATCTATTAAGGG - Intergenic
1109824085 13:67694441-67694463 GCTTTTTCCAAAAATACTGATGG + Intergenic
1110157722 13:72338875-72338897 GCTTTTTCAGCTTCTATTGAAGG - Intergenic
1113060221 13:106314499-106314521 CCTTTCTCTGCAACTACAGTGGG + Intergenic
1115737880 14:36354340-36354362 GCCTTTTCTGCATCTATTGAGGG - Intergenic
1120289640 14:82551082-82551104 GCCTTTTCTGCAACTGGTGCTGG - Intergenic
1120611764 14:86650044-86650066 ACTTTTTCTGCATCCATTGAAGG - Intergenic
1121972805 14:98374269-98374291 GCTTTTTCTACAGCTAAAGAGGG + Intergenic
1122061229 14:99137962-99137984 GCTTTTCCTGCAGGTAGTGAAGG + Intergenic
1122229843 14:100300773-100300795 GATTTTGCTGGAACAACTGAGGG + Intronic
1124140854 15:27076108-27076130 GCTCTTGCTGAAACCACTGATGG - Intronic
1124919125 15:34007797-34007819 GCTCTTTCTGGAAGTTCTGAGGG + Intronic
1127674754 15:61228759-61228781 GATTTTTCTGCAAACACTGGAGG - Intronic
1127993630 15:64138656-64138678 GCTGTGTGTGCAACTCCTGAGGG - Exonic
1129019644 15:72504633-72504655 GCTTTTTCCAAAACTACTGATGG - Intronic
1130714244 15:86315880-86315902 GTATTTTCTGAAACTACAGATGG - Intronic
1131051819 15:89353432-89353454 CCATTTTCTGCAACATCTGAAGG - Intergenic
1133547511 16:6822089-6822111 GATTTTTCTGCAGCTACTGGGGG + Intronic
1135427597 16:22352274-22352296 GCTTTTTCTACAACTCTAGAAGG + Intronic
1135650943 16:24206138-24206160 CCTTTTTCTGCTAATAATGAAGG - Intronic
1135948541 16:26889021-26889043 GCTTTTTCTGCAGCTCTTGGGGG - Intergenic
1140505262 16:75467765-75467787 ATTTTCTCTGCAAATACTGAAGG - Intergenic
1140692486 16:77497878-77497900 ACTTTTTGAGCACCTACTGAAGG - Intergenic
1143464958 17:7130647-7130669 GCTTTTTCTGCAGCAACTGGAGG - Intergenic
1144727823 17:17510768-17510790 GCTTGTTCTTCCACTGCTGAGGG + Intronic
1145282826 17:21480220-21480242 GCCTTTTCTGCACGTACTGCAGG + Intergenic
1145394651 17:22485577-22485599 GCCTCTTCTGCACCTACTGCAGG - Intergenic
1146423688 17:32714785-32714807 GCTTTTTTTGCAATTACTTTTGG - Intronic
1146522908 17:33540115-33540137 GGTTTTTCTGCAGCCTCTGAGGG + Intronic
1147715121 17:42501277-42501299 GCTTTCTCCTCAAATACTGACGG - Exonic
1148231200 17:45936143-45936165 GCTATCTGTGCAAATACTGAAGG - Intronic
1148290052 17:46438034-46438056 GCTTCCTCTGTGACTACTGAGGG + Intergenic
1148312220 17:46655606-46655628 GCTTCCTCTGTGACTACTGAGGG + Intronic
1153554944 18:6302529-6302551 GCTCTTCCTGCAACTCTTGAAGG + Intronic
1154303240 18:13213118-13213140 GCTTTTTCATCAAACACTGACGG - Intergenic
1154315851 18:13302678-13302700 GCTAGCTCTGCAACTACAGAGGG + Intronic
1155482045 18:26299294-26299316 ACTTTTTCTGCATCTATTTAAGG + Intronic
1155858185 18:30861969-30861991 GCTTATTTTCCAACTACAGAAGG + Intergenic
1157076115 18:44469610-44469632 TCCTTTGCTTCAACTACTGATGG + Intergenic
1166403092 19:42498519-42498541 GCTTATTCTGCAATTAGTGAAGG - Intergenic
1168620778 19:57877764-57877786 CCTTTTTCTTCAACTAGTGTGGG + Intronic
926770447 2:16368537-16368559 GCTTTCTTTCCCACTACTGAGGG + Intergenic
928470257 2:31568548-31568570 GCTTTTTCTGAACCTGCTCATGG - Intronic
932344096 2:70984595-70984617 GCTCTTTCTGCAACAACAGAGGG - Exonic
933424144 2:82088363-82088385 TTTTTTTCTGCTACTGCTGAGGG + Intergenic
933444293 2:82358217-82358239 GCTTTTTCTGCATAAATTGATGG + Intergenic
934997144 2:98974264-98974286 TTTTTTGCTACAACTACTGATGG - Intergenic
935915771 2:107947812-107947834 TCTTTTTCTTCAAATAATGAGGG + Intergenic
937012910 2:118577562-118577584 GCTTTTCCTGCTACTCCTGATGG + Intergenic
938973190 2:136450745-136450767 GCTTTTACTGGAATTACTCAGGG + Intergenic
941173841 2:162172639-162172661 GATCTTTCTTTAACTACTGAAGG - Intronic
945864537 2:215161711-215161733 GGTTTTGCTGCAGCTACTGTGGG - Intergenic
947644643 2:231729477-231729499 GCTTTTTCTGGATACACTGAAGG - Intergenic
948418367 2:237834934-237834956 GCAGTATCTGCGACTACTGAGGG - Intronic
948484930 2:238274448-238274470 CCTGTTTCTGAAATTACTGAAGG - Intronic
1169234377 20:3918183-3918205 AATTTTACTACAACTACTGATGG + Intronic
1169743066 20:8916097-8916119 GCTTATTCTGCAAGCACTGTGGG - Intronic
1170924949 20:20713672-20713694 GCTTTTTCAGCAAGTACTTAAGG + Intergenic
1172836351 20:37875674-37875696 GCATCTTCTGCCATTACTGAGGG + Intergenic
1174723315 20:52836366-52836388 GCATTCACTGGAACTACTGAAGG + Intergenic
1176883000 21:14220225-14220247 GTTTTTTCCGCCACTACTAAGGG - Intronic
1179196717 21:39171051-39171073 GCTTGTTCAGAAACTACAGATGG + Intergenic
1180257777 21:46644903-46644925 GCTTTTTTTTTAAATACTGAGGG - Intronic
1181903633 22:26175569-26175591 TCTTTTTTGGGAACTACTGAGGG - Intronic
1182302766 22:29347024-29347046 ACTTTTGCTGGAACTACTGAGGG + Intronic
1183195754 22:36352379-36352401 GCTCATTCTGCCACTGCTGATGG - Intronic
1184815679 22:46867600-46867622 GCTATTTCCACATCTACTGATGG - Intronic
949556168 3:5155140-5155162 AATTTTTCTCCAACTTCTGAAGG + Intronic
950609187 3:14114308-14114330 ACTTGATCTGCAACTGCTGATGG - Intronic
951132218 3:19061368-19061390 TATTTTTCAGCAAATACTGAAGG + Intergenic
952160949 3:30692412-30692434 GATTTTTCTGCAACCCATGAAGG - Exonic
953262854 3:41357046-41357068 GCATCTTCTGCAACCACTGGAGG + Intronic
953634033 3:44646855-44646877 GCCTTTTCAGCAAATACTGTTGG + Intronic
954127827 3:48542412-48542434 GCTTTTTCTAGAACTTCTGGTGG - Intronic
956067342 3:65411333-65411355 GCTTTTTATGCAAATACTTAAGG + Intronic
956385166 3:68709510-68709532 GCTTTTTCTGCATCCATTGAGGG + Intergenic
956518014 3:70071865-70071887 GCCTTTTCTTTAACTACAGAGGG - Intergenic
956750577 3:72341055-72341077 GCTTTTTCTTCAGCTTCTGGAGG - Intergenic
957166274 3:76677563-76677585 GCTCTTTCTGTGACTGCTGAGGG - Intronic
957302472 3:78410433-78410455 GCTTTTTGAGCAAGTACTAAAGG + Intergenic
958798265 3:98729733-98729755 GCCTTTTCTGCCATGACTGATGG - Intergenic
961585624 3:127920032-127920054 TCTTTTTCTGCAACTCCTGAAGG + Intronic
962242829 3:133765622-133765644 GCTTTTTCTATATCTGCTGAAGG - Intronic
963495074 3:146047920-146047942 GATTTTTTTTTAACTACTGAAGG - Intergenic
963517536 3:146326872-146326894 GCATCTGCTGCAACCACTGAAGG - Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
970023298 4:11593153-11593175 GTTTTTTCTGCCTCTACTCAGGG + Intergenic
970559771 4:17271155-17271177 CCTTTTTCAGCAAACACTGATGG + Intergenic
974733020 4:65895016-65895038 GCATATTCTGCTACTGCTGAAGG + Intergenic
975115087 4:70671327-70671349 GCATTTTCTGCAACTCCACAAGG - Intronic
978218349 4:106236597-106236619 GCTTTTTCTGAAATCACTGTTGG - Intronic
979449782 4:120857033-120857055 CCTTTTTGTGTAACTACTGTAGG - Intronic
984277729 4:177629790-177629812 GCTTTTTCAGCGACTGCTGCTGG - Intergenic
984598347 4:181697323-181697345 GCACTTCCTGCATCTACTGATGG - Intergenic
985504067 5:268534-268556 GCTTTTTCTGCATCATCTCAGGG - Intergenic
986269685 5:6219965-6219987 GCTTGTTCTGCAATTGGTGAAGG + Intergenic
986890761 5:12302177-12302199 GTGTTTTCTGCAGCTATTGAAGG - Intergenic
989797341 5:45492197-45492219 GCTTATTCTGCCTGTACTGAAGG - Intronic
990232872 5:53734055-53734077 GCTATGTCTGGAACTGCTGAGGG - Intergenic
990344725 5:54860866-54860888 GGTTTTTGTGCAACTAATAAAGG + Intergenic
991065156 5:62416568-62416590 ACTTTATCTCCAAATACTGAGGG + Intronic
991455890 5:66804019-66804041 GCTTTTTCTACATTTATTGATGG + Intronic
992771057 5:80048745-80048767 GCTTTTTCTGAAAGTACTCTGGG - Intronic
993694542 5:91045447-91045469 GCTTTTTCTGCATCTGTTGAGGG - Intronic
994007550 5:94857129-94857151 GCTTCATCTGCTACTACTGTTGG + Intronic
994957543 5:106552723-106552745 CATTTTTCTGAAACTACTGTTGG - Intergenic
997373565 5:133380978-133381000 GCTTTTTCTGCAACTACTGAGGG - Intronic
999760505 5:154696658-154696680 GCTTCTTCTGCCATTACTAATGG - Intergenic
1000191273 5:158913443-158913465 GCTATTTCTGAAAACACTGATGG - Intronic
1000499233 5:162027920-162027942 GCTTTTTTTGCATCTATTGATGG - Intergenic
1001136470 5:169106836-169106858 GGTTTGTCTGCAAAAACTGAAGG - Intronic
1003703470 6:8496749-8496771 GCTTTTGTTGCAACTGCTGTCGG + Intergenic
1005403172 6:25456345-25456367 GCTTATTCAGCAACAACAGAGGG - Intronic
1005437701 6:25832643-25832665 GCTCTTCCTGCAATTACTGTAGG + Intergenic
1006622368 6:35374712-35374734 GAATTTTCTGTAACTACTTACGG + Intronic
1008710856 6:54225569-54225591 CCTTTTTGTGCAACTTCTGCTGG - Intronic
1010076365 6:71803375-71803397 GGTCTTGCTGCAACTACTGTGGG + Intergenic
1011502173 6:88002749-88002771 ACCTTCTCTGCACCTACTGAGGG + Intergenic
1012931753 6:105324648-105324670 GGTTTTCCAGCAAGTACTGATGG - Intronic
1018106052 6:160487408-160487430 GCTTGATCTCCAACTACTGCAGG - Intergenic
1018440690 6:163809721-163809743 GCTTTTTCTACAAACACTTAGGG - Intergenic
1018477338 6:164156745-164156767 GGTTTTCCTGCAAATACTCACGG + Intergenic
1019608974 7:1926641-1926663 GCTTTTCCTGCATCAATTGATGG - Intronic
1022153278 7:27632411-27632433 GCTTTTTCAGCAACATCTGCTGG + Exonic
1024501182 7:50107849-50107871 ACTTTTTCTGCCACTACTCTTGG - Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1028480992 7:91304359-91304381 GCATTTTCTGCAACTAAAGATGG + Intergenic
1028629701 7:92921450-92921472 GCCTTTTCTGCATCTATTGAGGG + Intergenic
1028685867 7:93587975-93587997 GCCTTTTCTGCATCTATTGAGGG + Intergenic
1030882095 7:114893011-114893033 GCTTTTGCTGCAATTGCTGTTGG + Intergenic
1032451271 7:132033658-132033680 GCCTTTTCTGCATCTATTGAGGG + Intergenic
1038077467 8:24092438-24092460 GCTTTTTCTGCATCTATTGAGGG + Intergenic
1038591952 8:28847312-28847334 GCTTTTTCTTCACCTACCAAGGG + Intronic
1038916768 8:32032802-32032824 GCTTTTGTTGCAACTGCTGTTGG + Intronic
1039762411 8:40591596-40591618 GTTTTTTCTGCATCTTTTGATGG - Intronic
1043641884 8:82463799-82463821 TTTTTTTCTGCAATTGCTGATGG + Intergenic
1044238450 8:89858842-89858864 GCAGTATCTGCAACTACAGATGG + Intergenic
1045182044 8:99794833-99794855 GATTTTTCTGATATTACTGAGGG + Intronic
1045356858 8:101397036-101397058 GCTCTTTCTGAAAGTACCGAGGG - Intergenic
1048262210 8:132954747-132954769 GCATTTTCTCCATTTACTGAGGG + Intronic
1052767390 9:32655497-32655519 GCTTTTTTTGCAATTACTTTTGG - Intergenic
1055218029 9:73891413-73891435 CCTTCTTCTGTAACTACTCAGGG + Intergenic
1056644582 9:88399704-88399726 GATTTTTGTGCAGCAACTGAAGG - Intronic
1187123335 X:16430331-16430353 TATTTTTCTGTAACTAGTGAAGG - Intergenic
1188575975 X:31650552-31650574 TCCTTTTCTGGAACTACTTAAGG - Intronic
1194055112 X:89122307-89122329 GCTTTTTCTGCAATTGCTTTTGG + Intergenic
1194301343 X:92190089-92190111 GCTTTTTTTGCAATTGCTGTTGG + Intronic
1198472941 X:136965984-136966006 GCTTTTTCTATAACTTTTGAAGG + Intergenic
1198637896 X:138719838-138719860 ACTTTTCGTGCAACCACTGAAGG + Intronic
1199211572 X:145217721-145217743 TTTTTTTCTGCACCTATTGATGG + Intergenic
1199538490 X:148930810-148930832 GCTATTTCTGCAGCTTCTGCTGG + Intronic
1200282308 X:154787476-154787498 GCTTTTTCTGCATCTATTGAGGG - Intronic
1201505646 Y:14696413-14696435 GTTTCTTCTGCACCTTCTGAGGG + Intronic
1201991182 Y:20028526-20028548 GTTTTTCCTGCAACTACTTTTGG - Intergenic