ID: 997373821

View in Genome Browser
Species Human (GRCh38)
Location 5:133382963-133382985
Sequence GAACAGAGCGTGCAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997373821 Original CRISPR GAACAGAGCGTGCAACTGCC TGG Intronic
901675660 1:10882267-10882289 GAACAGACAGTGCAAAGGCCCGG - Intergenic
903554581 1:24184162-24184184 GAACAGCGTGTGCAAAGGCCTGG - Intronic
906531225 1:46525235-46525257 GACCAGGCAGTGCAACTGCCAGG + Intergenic
912679049 1:111717076-111717098 GAGCAGCCCATGCAACTGCCTGG + Intronic
917471376 1:175328748-175328770 GAACAGAGGGAGCAAGGGCCAGG + Intronic
921353501 1:214262088-214262110 GAACAGAGAGCTCATCTGCCTGG + Intergenic
1063135268 10:3210707-3210729 GAACATAGCATGCCACTGGCTGG - Intergenic
1064480819 10:15738885-15738907 GAACAGAGCGGAAAGCTGCCAGG - Intergenic
1069743399 10:70699813-70699835 GAACAGAGCCTTCCACTTCCTGG + Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1074722111 10:116272575-116272597 GAGCGGAGCCTGCAGCTGCCTGG + Intronic
1076893155 10:133294962-133294984 GAACAGCGAGTGCATCTTCCAGG + Intronic
1078634384 11:13035207-13035229 GAACAGAGTGTGCAAAGGCATGG + Intergenic
1078787851 11:14513239-14513261 GAACAGAGCTTACAACTGGCAGG + Intronic
1080913126 11:36625899-36625921 GAACAGCGAGTGCAAAGGCCAGG + Intronic
1084579068 11:70011186-70011208 GAACAGCGTGTGCAATGGCCTGG + Intergenic
1090388196 11:126368784-126368806 GATCTGAGCGTGCAAAGGCCTGG - Intronic
1091178749 11:133584159-133584181 GAACAGATTGTACACCTGCCAGG - Intergenic
1095857578 12:46877517-46877539 TGACAGAGCCTGCATCTGCCAGG - Intergenic
1102451945 12:113048585-113048607 GAACAGTGGGTGCTACAGCCTGG + Intergenic
1104246039 12:127042542-127042564 GAACAGAGTGTGAAACTGCAAGG - Intergenic
1120955632 14:90079549-90079571 CAGCAGAGCCTGCAACTGCTGGG + Intronic
1121608619 14:95259911-95259933 GAACAGCGTGTGCAAAGGCCTGG - Intronic
1122094568 14:99361754-99361776 GCACAGCGCGTGTAACTGCTTGG - Intergenic
1122245198 14:100397719-100397741 GAACAGAGTGTGCAAAGGCAGGG + Intronic
1123932389 15:25178141-25178163 GGGCAGACTGTGCAACTGCCAGG + Intergenic
1127626871 15:60788378-60788400 GAACAGTGTGTGCAAAGGCCAGG + Intronic
1128380472 15:67108179-67108201 GCACAGAGTCTGCAGCTGCCAGG - Intronic
1129816317 15:78557570-78557592 GAAAAGAGCTTGCTACGGCCGGG - Intergenic
1129974821 15:79813289-79813311 GAGCAGAGAGGACAACTGCCTGG - Intergenic
1131360103 15:91783227-91783249 AAACAGAGTGTGGAAGTGCCTGG - Intergenic
1136612816 16:31377627-31377649 GCTCAGAGCGTGCACCTGGCTGG - Intronic
1141624415 16:85253745-85253767 GAACTGTGCGTGCAAAGGCCAGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1143181889 17:4988483-4988505 GGCCAGAGAGTGCAGCTGCCTGG + Exonic
1148190118 17:45672414-45672436 GATCTGAGCGTGCAGCTCCCAGG - Intergenic
1151311071 17:73292710-73292732 GAACGGCGCGTGCAAACGCCGGG + Intronic
1151619555 17:75237630-75237652 GGACACAGCCTGCCACTGCCAGG + Exonic
1152637733 17:81437034-81437056 GAACAGTGCCTGCCACTGCTGGG + Intronic
1155465788 18:26133873-26133895 CAACACAGCGTGCTACCGCCCGG - Exonic
1164861540 19:31565747-31565769 GAGCACAGCCTGCAACTGGCGGG - Intergenic
1165052463 19:33150770-33150792 GAACAGTGCTTGCAAAGGCCTGG - Intronic
1168076720 19:53984382-53984404 GGACAGAGTGACCAACTGCCAGG + Exonic
925988041 2:9231689-9231711 GAACACAGCATGCAGATGCCAGG - Intronic
931906123 2:66845819-66845841 GAAAAGCCAGTGCAACTGCCAGG - Intergenic
938092827 2:128444504-128444526 GAGCAGATGGTGCCACTGCCAGG - Intergenic
1169068913 20:2709774-2709796 GAGCAGAGAGGGAAACTGCCAGG + Intronic
1173947730 20:46965047-46965069 GAACAGACGGTGGAACTGCCAGG + Intronic
1175954074 20:62599416-62599438 GCACAGGGCCTGGAACTGCCAGG - Intergenic
1176230079 20:64028082-64028104 GAACAGAGCCTGCACCTAGCAGG - Intronic
1177193729 21:17880456-17880478 GAAAGGTGCGTGCAACTGCTAGG + Intergenic
1181115612 22:20631234-20631256 CAACAGAGGGTGGAACTGGCTGG - Intergenic
1184853141 22:47132239-47132261 GAACATGGGGTGCAACCGCCAGG - Intronic
950431427 3:12953256-12953278 CATCAGAGCCTGGAACTGCCGGG + Intronic
951109775 3:18789441-18789463 GAACATTGCGTGCCACTTCCAGG + Intergenic
961764829 3:129201286-129201308 GAACAGTGTGTGGAAATGCCCGG - Intergenic
967381153 3:188859574-188859596 GAACAAAGTGTTCAACAGCCTGG - Intronic
969370291 4:6727552-6727574 GAACAGCTCGTGCAAAGGCCCGG - Intergenic
982229162 4:153192743-153192765 GAACAGTGGGTGCAAAGGCCCGG - Intronic
997373821 5:133382963-133382985 GAACAGAGCGTGCAACTGCCTGG + Intronic
997555478 5:134794188-134794210 GTACAGAGCTTGCAAGAGCCAGG - Intronic
998341969 5:141426317-141426339 GAAGAGTGCTTGCCACTGCCGGG - Intronic
999096065 5:148979173-148979195 GAACAGTGCATACAACTGACGGG + Intronic
999366002 5:151023871-151023893 GAAGAGAGCTTGCAGCTGCCAGG + Intronic
1001534487 5:172489035-172489057 GGACACAGCCTGCTACTGCCAGG - Intergenic
1005266941 6:24122072-24122094 GTACAGAGGGTGCAGCTGGCTGG - Intergenic
1012097911 6:94988942-94988964 GAATAGAGCCTGCTACTTCCAGG - Intergenic
1015420760 6:133005358-133005380 GAACTGAGAGTGCAAAAGCCTGG - Intergenic
1016457852 6:144249787-144249809 GAACAGAGGAGGAAACTGCCTGG - Intergenic
1016739561 6:147513041-147513063 GAACAGTGTGTGCAAAGGCCAGG + Intronic
1019018992 6:168901852-168901874 TAACAGAGAGTGAAACTGACCGG - Intergenic
1020660014 7:10971232-10971254 AAACAGTACGTGCAACTTCCAGG - Intergenic
1021774788 7:24042204-24042226 GAACAGAGCAGTCAGCTGCCTGG + Intergenic
1031997039 7:128239865-128239887 GAACCGAGCCTGCCACTGCCGGG - Intergenic
1032790544 7:135239296-135239318 GAACCCAGCGTGCAGCTCCCAGG - Intronic
1034566348 7:151918737-151918759 GAACAGAGCCAGCAACTACCTGG + Intergenic
1035481814 7:159192826-159192848 GCAGAGGGCCTGCAACTGCCAGG - Intergenic
1038431168 8:27500958-27500980 GACCAGAGGGTGCCACTACCCGG + Exonic
1042834969 8:73071301-73071323 GACCTGAGCGTGCAGCTGTCTGG + Intronic
1043854117 8:85245431-85245453 CACCAGAGCCTGGAACTGCCAGG - Intronic
1045660127 8:104428605-104428627 GAACAGAGGGTGAGACTGGCTGG + Intronic
1046832650 8:118763310-118763332 GAGCAGAGTGTGGAGCTGCCTGG + Intergenic
1048003459 8:130399056-130399078 GAACAGGAGGTGCAACTTCCAGG + Intronic
1050280585 9:4045995-4046017 GAACAAAAAGTGCAACTGCCAGG + Intronic
1056618671 9:88191491-88191513 GAAAAGAGGGGGCAACTTCCTGG + Intergenic
1057099938 9:92349109-92349131 GAACAGAGCATCCAAATGCTGGG - Intronic
1059453804 9:114387342-114387364 GACCAGAGCTGGCAACAGCCAGG - Intronic
1186142747 X:6594054-6594076 GACCAGAACGTGCTACTTCCAGG + Intergenic
1186829616 X:13377710-13377732 GAGCAGAGCGTCCAACAGCTGGG + Intergenic
1187048614 X:15674767-15674789 GCAGAGAGCGTGCAACTGGCGGG + Intergenic
1189492631 X:41481885-41481907 GGACAAAGCGGGCCACTGCCTGG - Intergenic
1198846486 X:140917925-140917947 GTACAGAGCGTGCAAAGGCCAGG + Intergenic