ID: 997377255

View in Genome Browser
Species Human (GRCh38)
Location 5:133406072-133406094
Sequence GATGGTGTTAAATGCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997377255 Original CRISPR GATGGTGTTAAATGCGAGGA AGG Intronic
905490192 1:38337475-38337497 GACCTTGTTAAATGTGAGGAAGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
908051045 1:60230851-60230873 AATGTTGTTAAATGTGTGGAGGG + Intergenic
908288064 1:62630794-62630816 AATGGTGTTAAATGAGAAAAAGG + Intronic
908637407 1:66183465-66183487 GCTCGTGTTAAATGAGGGGAGGG - Intronic
912438613 1:109680685-109680707 GGGGGTGTTAAATGCAGGGAGGG + Intronic
912441134 1:109699130-109699152 GGGGGTGTTAAATGCAGGGAGGG + Intronic
914258182 1:145977380-145977402 GAGGGTTTTAAAGGAGAGGAAGG - Intronic
915100280 1:153494418-153494440 GATGTTGTTAAATATCAGGATGG + Intergenic
915995356 1:160557113-160557135 GATGGTATTAAATGAGATAATGG - Intronic
916852301 1:168715830-168715852 GATGGTGGGAAATGCAAAGAAGG - Intronic
919692326 1:200539122-200539144 GATGGTGTTAAAAGTCAGGGTGG + Intergenic
1065215343 10:23442851-23442873 GATGGTGTCATCTGTGAGGAAGG + Intergenic
1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG + Intergenic
1068876011 10:61997655-61997677 GATGGTGTTAAGTGCTATGAGGG + Intronic
1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG + Intergenic
1074535015 10:114322618-114322640 GGTGGTGATAAGTGAGAGGATGG - Intronic
1079971414 11:27040400-27040422 GAGGGTGTTAGGTGGGAGGAGGG + Intergenic
1080926474 11:36761843-36761865 TATGGTGTTAATTGTTAGGATGG - Intergenic
1081820384 11:45988035-45988057 GATGATGCTAAATTGGAGGAGGG + Intronic
1083962152 11:66020587-66020609 GATGATGTAAATTACGAGGATGG + Exonic
1084917001 11:72435988-72436010 GATGGTGATAAATGCTGTGAAGG - Intergenic
1087850034 11:103017570-103017592 GATGGTGTTTAAAGTGATGAGGG + Intergenic
1089176272 11:116551112-116551134 GAGGGTGTGAGATGAGAGGATGG + Intergenic
1089545252 11:119219471-119219493 GAAGGTGTTAAATTTGTGGATGG + Intronic
1091722221 12:2821593-2821615 GATGGTGAGCAATGCTAGGATGG + Exonic
1093044417 12:14426391-14426413 GATGGTGTTTTATGCTAGCAAGG - Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1095671607 12:44867688-44867710 GATGATGTCAAATGCAAGCAGGG - Intronic
1100868846 12:98888808-98888830 GATGGTGATAAAGGCCATGAAGG - Intronic
1100875449 12:98956853-98956875 GATGGTGGTAAATTCAAGGCAGG - Intronic
1101254388 12:102963436-102963458 GATAGTGGTAAATGCCAGGAAGG - Intergenic
1102575242 12:113852069-113852091 AATGCTGTTAAAAGGGAGGAAGG + Intronic
1104596459 12:130123422-130123444 GAGGGTGTTAAATACGAAGAAGG - Intergenic
1106708159 13:32303255-32303277 GATTGTGATAAATGCCATGAAGG - Intergenic
1112065367 13:95787192-95787214 GGTGGTGTTAGAAGCGAGGGTGG + Intronic
1112849039 13:103681487-103681509 GATTTTGATAGATGCGAGGATGG - Intergenic
1112964336 13:105168828-105168850 AATGGTGTTAAAGGCTATGAAGG + Intergenic
1113755589 13:112808688-112808710 GATGGTGTGAAAAGAGAGGCGGG - Intronic
1117453634 14:55876255-55876277 GAAGGTGTTAAATGCATTGAGGG + Intergenic
1118702106 14:68443507-68443529 GATGCTGACAAATGAGAGGAGGG + Intronic
1118773402 14:68957482-68957504 GATGGCTTTAAATGCCAGAATGG - Intronic
1120531816 14:85641177-85641199 CATGGTGTTTAATGCCAGGGTGG + Exonic
1122382580 14:101319448-101319470 CATGGAGTTAAATGCTAGAATGG + Intergenic
1126435910 15:48637330-48637352 GATGTTGTGAAAGGCAAGGACGG - Intronic
1129011736 15:72424606-72424628 AATTGTGTTAAATGCTAAGAAGG + Intergenic
1130060020 15:80563026-80563048 GATGGTGCCAAACGGGAGGAGGG - Intronic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1133602109 16:7349825-7349847 GATGCTGTTAGCTGCTAGGAAGG + Intronic
1136248098 16:28986440-28986462 GATGGTGGTAAGTGTGGGGAAGG + Exonic
1138083722 16:54115457-54115479 GATGGTTGTAAGTGCCAGGAAGG + Exonic
1141676283 16:85519242-85519264 GATGGTGGTAAAAGTGACGATGG - Intergenic
1141676295 16:85519324-85519346 GATGGTGGTAAAAGTGATGATGG - Intergenic
1141676304 16:85519394-85519416 GATGGTGGTAAAAGTGATGATGG - Intergenic
1141676313 16:85519464-85519486 GATGGTGGTAAAAGTGATGATGG - Intergenic
1144271646 17:13623388-13623410 CATGGTGTTAAATGCAATCAGGG - Intergenic
1146393081 17:32440768-32440790 GACTGTGTTAAATGCTAGGAAGG + Intergenic
1151744504 17:76004704-76004726 TCTGGTGTTGAATGAGAGGAAGG + Intronic
1156905737 18:42349625-42349647 GTTGGTGTTAAATGTGATGCAGG - Intergenic
1159425065 18:68274614-68274636 GATGGTGTTAAATCCAAATATGG - Intergenic
1159757438 18:72383070-72383092 GTTGGTGTGAAATGTGAGAAAGG + Intergenic
925002002 2:410431-410453 GATGGTGTGGACTGTGAGGATGG - Intergenic
925002019 2:410534-410556 GATGGTGTGGACTGTGAGGATGG - Intergenic
929101615 2:38320243-38320265 GATGGTGTTAAATTAGGGTAAGG + Intronic
930537219 2:52658478-52658500 GTTGGTGTTAAAAGGGAGGGTGG - Intergenic
930592089 2:53340205-53340227 GAGGGTGGAAAATGAGAGGAGGG - Intergenic
931149203 2:59554220-59554242 CATTGTGTTAAATGCAAAGAAGG - Intergenic
939050616 2:137302767-137302789 GATGTTCTTAAAAGCGAGAATGG + Intronic
946407361 2:219498725-219498747 GGCGGGGTTAAATGCGAAGAAGG - Intergenic
947135380 2:226972364-226972386 AAAGGTGCTAAATGAGAGGAGGG + Intronic
1175032320 20:55968074-55968096 GATTGTGTTAAGTGTGAAGAAGG - Intergenic
1184553781 22:45220937-45220959 GATGGTGATACAGGCCAGGATGG - Intronic
949218132 3:1596224-1596246 GATGGTGCCAAAAGCGAAGAAGG - Intergenic
950581959 3:13868164-13868186 GTTGGGGGTAAATTCGAGGAAGG + Intronic
950850058 3:16053720-16053742 GATGGTGGTAAGTGCTATGAAGG + Intergenic
951044995 3:18028209-18028231 GATTGTGTTAAATGCCAAGAAGG + Intronic
952285797 3:31968669-31968691 GATGGTCTTAAAAGCCAGAATGG - Intronic
957928527 3:86846701-86846723 GATGATGGTCAATGCAAGGAGGG - Intergenic
958883023 3:99694547-99694569 GATCATGTTAAATGCTATGAGGG - Intronic
961644080 3:128383178-128383200 GATAGTGCTAGATGCTAGGAAGG - Intronic
961683499 3:128614416-128614438 GATAGTGATAAATGCTATGAAGG - Intergenic
962036454 3:131656746-131656768 GATGGTGGTAAGTGCCATGAAGG + Intronic
965903796 3:173677369-173677391 GATGGAGTTACATGCAAGAAAGG - Intronic
966011423 3:175083118-175083140 GATGTTGGTAAATTCTAGGATGG + Intronic
970224338 4:13841810-13841832 GAAGGTGGAAAATGGGAGGAAGG + Intergenic
970587050 4:17524150-17524172 GATGGTCATAAATGAGAGCATGG - Intronic
971798470 4:31258717-31258739 GATGGTGGAATATGGGAGGAGGG + Intergenic
972573131 4:40328806-40328828 GCTGGTCCTAAGTGCGAGGAAGG + Intergenic
976859997 4:89653126-89653148 GATTGTTTTAAATGCTAGGTTGG + Intergenic
976958456 4:90935197-90935219 GATGGGGTTTAATGGGAGAATGG + Intronic
977421817 4:96810444-96810466 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
978824905 4:113010606-113010628 GGTTGTGATAAATGCTAGGAAGG + Intronic
982444152 4:155470720-155470742 GATGGTGTGAGAGGAGAGGATGG - Intergenic
985139855 4:186828815-186828837 GATGGTGTGAAATGGGAGGAGGG - Intergenic
986865684 5:11983845-11983867 GATGGTTTTAGATATGAGGATGG + Intergenic
990826639 5:59907433-59907455 GATGGTGGAAGATGGGAGGAGGG + Intronic
992767703 5:80016339-80016361 GTAGGTGTTATATGGGAGGAAGG - Intronic
995141571 5:108741132-108741154 GATTGTGATAAATGCTAGGAAGG - Intergenic
995238352 5:109856961-109856983 GATGGTGTTAAGTGTTATGAAGG + Intronic
997377255 5:133406072-133406094 GATGGTGTTAAATGCGAGGAAGG + Intronic
999377284 5:151095634-151095656 GATGGTGGTAGTTGGGAGGAAGG + Intergenic
1000285508 5:159823061-159823083 GATACTGTTAAATGCTAGGAAGG + Intergenic
1004495316 6:16157386-16157408 GATAGTGATAAATGCTATGAAGG - Intergenic
1004574136 6:16876860-16876882 GATGGTGAAACATGGGAGGAGGG - Intergenic
1005002234 6:21253559-21253581 GAGGGTGTGAGATGTGAGGAAGG - Intergenic
1009743678 6:67783552-67783574 GAGGGTGTTAATTAAGAGGATGG - Intergenic
1010731370 6:79394984-79395006 AATAGTGTTAAATTAGAGGATGG + Intergenic
1013227851 6:108133561-108133583 GATGGTGTTAACTCTGAGTATGG - Intronic
1014311950 6:119814558-119814580 GATTGTGATAAATGCTATGAAGG - Intergenic
1015798552 6:137037369-137037391 GATGGTCTTAAATGCAACTAAGG - Intronic
1016628054 6:146195807-146195829 GATAGTGGTAAATGAAAGGATGG + Intronic
1017241418 6:152173661-152173683 CATGGTGTTAAACTCCAGGATGG + Intronic
1024121805 7:46249591-46249613 GATGGTGCAAAATGCAAGTATGG - Intergenic
1028370753 7:90089116-90089138 GGTGGTGTTACATGTGAGAAGGG - Intergenic
1031445246 7:121845751-121845773 GATGGGGATAAAAGGGAGGAAGG + Intergenic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1035918500 8:3651793-3651815 GATGGTGGTAAGTGCGATGGTGG - Intronic
1036077959 8:5522223-5522245 ATTGGTGTTAAATGTGGGGATGG + Intergenic
1039885401 8:41651350-41651372 GATGGGGGTAAGTGCGGGGATGG + Intergenic
1040685921 8:49873077-49873099 GATGGTGTTAGAAGGGAGGAGGG - Intergenic
1048629207 8:136222900-136222922 GAAGGAGTTAAAAGAGAGGAAGG + Intergenic
1048934545 8:139344111-139344133 GATGCTGTTGAAGGAGAGGAAGG + Intergenic
1057158239 9:92864036-92864058 GATGGGGTTGAATGCCAAGATGG + Intronic
1058169345 9:101661024-101661046 GATTGTGTTAAGTCCTAGGAGGG + Intronic
1058370951 9:104266985-104267007 GTTGGTGGTAAGTGCTAGGAAGG + Intergenic
1060734347 9:126056856-126056878 GATGGTGTTATGTGCCAGGAGGG - Intergenic
1062362427 9:136194109-136194131 GATGGGGTTGGACGCGAGGATGG - Intergenic
1188984909 X:36760563-36760585 GATGGTGGGAAATGCGTGAATGG - Intergenic
1189679576 X:43501582-43501604 GATGTTGTTAATAGAGAGGATGG - Intergenic
1189871656 X:45390595-45390617 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
1193318352 X:80091666-80091688 GATTGTGTTAAGTGATAGGATGG - Intergenic
1198159693 X:133995294-133995316 GAGGGTGGAAAATGCGAGGAGGG + Intergenic
1199558842 X:149140856-149140878 GATGGAGTAAAATAGGAGGAAGG - Intergenic
1200375912 X:155780005-155780027 GCTGCTGTTAAAGGCCAGGATGG + Exonic
1201958714 Y:19654277-19654299 GATGGTGGAATATGAGAGGAGGG - Intergenic