ID: 997377619

View in Genome Browser
Species Human (GRCh38)
Location 5:133408559-133408581
Sequence ACTGAGGCGGGGGTGGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997377609_997377619 3 Left 997377609 5:133408533-133408555 CCGAGCTGAGGATGCAGCTCCTC No data
Right 997377619 5:133408559-133408581 ACTGAGGCGGGGGTGGAGCGGGG 0: 1
1: 0
2: 0
3: 40
4: 478
997377607_997377619 26 Left 997377607 5:133408510-133408532 CCACGCTGCTGTGGGGGAGCTGA 0: 1
1: 0
2: 0
3: 17
4: 229
Right 997377619 5:133408559-133408581 ACTGAGGCGGGGGTGGAGCGGGG 0: 1
1: 0
2: 0
3: 40
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997377619 Original CRISPR ACTGAGGCGGGGGTGGAGCG GGG Intronic