ID: 997379971

View in Genome Browser
Species Human (GRCh38)
Location 5:133428610-133428632
Sequence GTGTGACCACTTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997379971_997379974 -3 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379974 5:133428630-133428652 CACAGCACAAGTGACTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 204
997379971_997379979 19 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379979 5:133428652-133428674 GTGCAGAGGTGCTGCATATAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
997379971_997379975 5 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379975 5:133428638-133428660 AAGTGACTGCCCAGGTGCAGAGG 0: 1
1: 1
2: 5
3: 157
4: 1170
997379971_997379978 18 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379978 5:133428651-133428673 GGTGCAGAGGTGCTGCATATAGG 0: 1
1: 0
2: 0
3: 14
4: 128
997379971_997379980 20 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379980 5:133428653-133428675 TGCAGAGGTGCTGCATATAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997379971 Original CRISPR GTGTGACCACTTGGTGCTCA GGG (reversed) Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
906846646 1:49199956-49199978 GTGTGACTACTTGATGCTGGAGG + Intronic
911472444 1:98334917-98334939 GAGTGATCACTGGGTGGTCAGGG - Intergenic
913430448 1:118785427-118785449 AAGTGAGAACTTGGTGCTCAGGG - Intergenic
918546276 1:185688142-185688164 CTGTGGGCACTTGGTGGTCAGGG - Intergenic
920556972 1:206911112-206911134 TTGAAACCACTTGGTTCTCATGG + Intronic
921112790 1:212055302-212055324 GGGAGACCCCTTGATGCTCACGG + Intronic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
922773017 1:228198986-228199008 CTGTACCCACATGGTGCTCAAGG + Intergenic
1063320628 10:5049368-5049390 GTATTACCATGTGGTGCTCAAGG - Intronic
1064125743 10:12658603-12658625 GTGTGCCCACTAGGGTCTCAGGG - Intronic
1064453870 10:15468797-15468819 GTGAGACAAATTAGTGCTCAGGG - Intergenic
1065433306 10:25681681-25681703 TTGTGCCCGCTTGGTGCTCCAGG + Intergenic
1067265017 10:44734277-44734299 GAGTGTCCACCTGGTGGTCAGGG - Intergenic
1077316863 11:1923249-1923271 GTGTGGCCACATGGTCCTGAGGG + Intronic
1080211826 11:29795158-29795180 GTTAGACTACTTGGGGCTCAGGG - Intergenic
1081456350 11:43227039-43227061 GTGTAACCTCTTCCTGCTCAAGG + Intergenic
1083746534 11:64740066-64740088 GTTTGACCACCTGGAGCCCATGG - Exonic
1088828438 11:113515354-113515376 TTGTGACCAGTTGGTGTTTAAGG - Intergenic
1096154211 12:49332891-49332913 GGGCGAACTCTTGGTGCTCAAGG - Exonic
1096612531 12:52812163-52812185 ATGTGACCCCTTGGTGCTATGGG - Intronic
1098747150 12:74253357-74253379 GTGTAACCATTTGTTTCTCATGG - Intergenic
1103779738 12:123390204-123390226 GATTAACCACTTGGTGCTGAGGG - Intronic
1106132749 13:26953193-26953215 CTGGGACCACCTGGTGCCCAGGG - Intergenic
1106468335 13:30032960-30032982 GTGTAACCACGTGGGGGTCAGGG - Intergenic
1107449077 13:40492428-40492450 GTGGCACCACTTGGCTCTCAGGG - Intergenic
1108356485 13:49633099-49633121 GTGTGACCTCTTGTTGCTTGAGG + Exonic
1109845314 13:67981480-67981502 GTTTGGTCACTTGGTGCTCTTGG + Intergenic
1110012589 13:70356617-70356639 ATTTGTCCACTTGGTGATCAAGG + Intergenic
1117045464 14:51808883-51808905 GTGTGACCTCTTGCTCCACAAGG - Intergenic
1118823555 14:69360873-69360895 GTGTCACCACGTGGTGCAGAAGG + Intergenic
1122112698 14:99513364-99513386 GGGTGAACACCTGCTGCTCATGG - Exonic
1128241841 15:66106735-66106757 GTGTGTCCACGTGGTGCATATGG - Intronic
1131368485 15:91860221-91860243 CTGTGGCCACTGGGTGCTGAAGG + Intronic
1132466331 16:78923-78945 GGGTGACCACCGCGTGCTCAGGG - Intronic
1133221485 16:4320879-4320901 GGGTGACCACTAGGTGCTCCGGG - Intronic
1135769940 16:25210169-25210191 GTATTACCACTTGGAGCTCAGGG - Intergenic
1140894344 16:79311855-79311877 GTGTGCCCATTTTGTTCTCAGGG - Intergenic
1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG + Intergenic
1145156554 17:20548544-20548566 CTGGGACCACCTGGAGCTCAAGG - Intergenic
1150669234 17:67176030-67176052 GTGGCAACACTTGCTGCTCATGG - Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152343332 17:79737348-79737370 GTGGCCCCACTTGGGGCTCAAGG - Intronic
1152618458 17:81348725-81348747 GTCTGACCACGTGCTGCTGATGG + Intergenic
1154906391 18:20578247-20578269 ATGTGGACACTTGGTGCGCATGG - Intergenic
1157002402 18:43542515-43542537 GTGTGACCACTAGGGTCTCAGGG + Intergenic
1157648575 18:49303566-49303588 GTGTGACCCTTTGGTGCACGTGG + Intronic
1157771946 18:50356742-50356764 ATCTGCCCACATGGTGCTCACGG + Intergenic
1163420028 19:17209199-17209221 GTATGCCCACTTGGTGGTCAAGG - Intronic
1166080466 19:40441163-40441185 CTGTGACCACTGGGGCCTCAGGG - Exonic
1166713425 19:44951475-44951497 CTGTGTCCACTTGGTTCCCACGG + Intronic
1167551366 19:50163104-50163126 GTGCGACCCCTTGGTGCTGGAGG - Exonic
925533962 2:4895504-4895526 CTGTGACCACTTGGGGCTTACGG - Intergenic
926088980 2:10037873-10037895 ATGGGACCCCTTGGTGCTCAGGG - Intergenic
935664043 2:105494769-105494791 GTGTGCCCCCTTGGGTCTCAGGG + Intergenic
935720003 2:105971690-105971712 GTGTGGCCACCTAGGGCTCAGGG - Intergenic
939019294 2:136939910-136939932 GTGTCACCACTTGGTACTTCAGG - Intronic
940448228 2:153803758-153803780 ATATGACCTCTTCGTGCTCATGG - Intergenic
944514919 2:200503066-200503088 GTGAGACCACAAGGTGCTCCAGG + Intronic
947588841 2:231373086-231373108 ATGTGTCCACTCTGTGCTCAGGG + Intronic
947612837 2:231534188-231534210 GTGTGCCCACAGGGTGCTCCTGG + Intergenic
1175642337 20:60641368-60641390 GAGTGCCCACTGTGTGCTCATGG + Intergenic
1179503026 21:41821693-41821715 CTGTGTCACCTTGGTGCTCAGGG - Intronic
1182725537 22:32442288-32442310 GTGCGAGGACTTGATGCTCAGGG + Intronic
1183218459 22:36496478-36496500 ATGTGAGCACTTTGTGTTCAAGG + Intronic
1183297833 22:37042491-37042513 GTGTGAACACTTGGTGCGTCTGG + Intergenic
1183320462 22:37162286-37162308 GTGTGAGCATTGGATGCTCAAGG + Intronic
1183795134 22:40111218-40111240 GCGAAACCACGTGGTGCTCAAGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185258798 22:49850273-49850295 GAGTGACCAGTAGGTGCCCAGGG + Intergenic
951866132 3:27310373-27310395 GTGTTAACACATGCTGCTCATGG - Intronic
952737816 3:36707592-36707614 GTGTCACCACTTGGTTCCCGGGG - Intergenic
954216642 3:49128495-49128517 GTGTGGGCATTTGGTGCCCAAGG - Exonic
955360299 3:58268458-58268480 GTGTGGCAACTTGCTGCTCTTGG + Intronic
960576091 3:119231076-119231098 GTGTGTCTACTTGTTGGTCAAGG - Intronic
961344288 3:126252507-126252529 GCTTGGCCACTTGGTGCTCCTGG - Intergenic
961537541 3:127579148-127579170 TTGTCACCACTTGGTGGTCCTGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971716847 4:30188893-30188915 GTTTGATCACTTGGTGCTCCTGG + Intergenic
981810494 4:148768760-148768782 GAGTGGACCCTTGGTGCTCAAGG + Intergenic
989498509 5:42138225-42138247 GTGTGCCCACTAGGGTCTCAGGG + Intergenic
992956817 5:81918442-81918464 GTGTGACCACTCGTTGGGCAAGG - Intergenic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
1011068297 6:83353847-83353869 GCCTGACCACTTTCTGCTCAAGG - Intronic
1011102800 6:83743360-83743382 GAGTGACCGCTTGGTGATCCTGG + Intergenic
1012779734 6:103542578-103542600 GTGAGAGGTCTTGGTGCTCAGGG + Intergenic
1014373740 6:120645125-120645147 GAGAGATCACTTGGTGATCAAGG + Intergenic
1016223441 6:141704855-141704877 GGGTGACAACGTGGGGCTCAGGG - Intergenic
1016778585 6:147933756-147933778 ATGTGTCCAATTTGTGCTCATGG - Intergenic
1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG + Intergenic
1022343702 7:29492941-29492963 GTTTGAACACTGAGTGCTCAGGG + Intronic
1023253498 7:38290445-38290467 GTGTGCCCACTAGGGTCTCAGGG - Intergenic
1023296991 7:38725366-38725388 GTGGGACCACCTGATGCTGAAGG - Exonic
1034966651 7:155395556-155395578 CTCTGTCCCCTTGGTGCTCAGGG + Exonic
1035027655 7:155836461-155836483 GTGTGACTCCGTGGGGCTCAAGG - Intergenic
1035817162 8:2553645-2553667 GTGAGATCACTTGCTTCTCAGGG - Intergenic
1036616764 8:10393819-10393841 GTGTGCACACGTGGTGCACAGGG - Intronic
1036659327 8:10697846-10697868 GTGTGGCCACCTGCTGCTCGTGG - Exonic
1040318405 8:46276902-46276924 CTGTGACCCATTGCTGCTCATGG + Intergenic
1047782906 8:128124215-128124237 GTGTGGCCTCTTTCTGCTCAAGG + Intergenic
1048123536 8:131607976-131607998 GTGTGCCCACTAGGGTCTCAGGG + Intergenic
1055290639 9:74778823-74778845 GGGTGAACACCTGCTGCTCATGG - Intronic
1060934937 9:127509249-127509271 GGATGGCCACCTGGTGCTCATGG + Intronic
1062290421 9:135791915-135791937 CAGTGCCCACCTGGTGCTCAGGG - Intronic
1189382710 X:40513159-40513181 GTTTGTCCACTTGCTGCTCTTGG - Intergenic
1189525932 X:41822075-41822097 GCTTCACCACATGGTGCTCAAGG - Intronic
1197965242 X:132053434-132053456 GTGTGTCCATTTGGTGATCATGG + Intergenic
1200055530 X:153458018-153458040 GTGTGACAAGTTGGCGCTGAAGG - Intronic
1202019669 Y:20451475-20451497 GTGTGCCCACTAGGGTCTCAGGG - Intergenic