ID: 997379971

View in Genome Browser
Species Human (GRCh38)
Location 5:133428610-133428632
Sequence GTGTGACCACTTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997379971_997379975 5 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379975 5:133428638-133428660 AAGTGACTGCCCAGGTGCAGAGG 0: 1
1: 1
2: 5
3: 157
4: 1170
997379971_997379974 -3 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379974 5:133428630-133428652 CACAGCACAAGTGACTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 204
997379971_997379979 19 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379979 5:133428652-133428674 GTGCAGAGGTGCTGCATATAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
997379971_997379980 20 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379980 5:133428653-133428675 TGCAGAGGTGCTGCATATAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
997379971_997379978 18 Left 997379971 5:133428610-133428632 CCCTGAGCACCAAGTGGTCACAC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 997379978 5:133428651-133428673 GGTGCAGAGGTGCTGCATATAGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997379971 Original CRISPR GTGTGACCACTTGGTGCTCA GGG (reversed) Intronic