ID: 997389004

View in Genome Browser
Species Human (GRCh38)
Location 5:133498066-133498088
Sequence GGGGTGCTAAAGAATATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997389004_997389016 12 Left 997389004 5:133498066-133498088 CCCATAATATTCTTTAGCACCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 997389016 5:133498101-133498123 ATACTGGGAGTTGGAGCAGTGGG No data
997389004_997389015 11 Left 997389004 5:133498066-133498088 CCCATAATATTCTTTAGCACCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 997389015 5:133498100-133498122 CATACTGGGAGTTGGAGCAGTGG No data
997389004_997389009 -3 Left 997389004 5:133498066-133498088 CCCATAATATTCTTTAGCACCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 997389009 5:133498086-133498108 CCCCCCAATAAATACATACTGGG No data
997389004_997389007 -4 Left 997389004 5:133498066-133498088 CCCATAATATTCTTTAGCACCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 997389007 5:133498085-133498107 CCCCCCCAATAAATACATACTGG 0: 1
1: 0
2: 0
3: 10
4: 99
997389004_997389014 3 Left 997389004 5:133498066-133498088 CCCATAATATTCTTTAGCACCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 997389014 5:133498092-133498114 AATAAATACATACTGGGAGTTGG 0: 1
1: 0
2: 1
3: 61
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997389004 Original CRISPR GGGGTGCTAAAGAATATTAT GGG (reversed) Intronic
903104164 1:21060334-21060356 GGGGTGCCAGTGAATATAATAGG + Intronic
907910951 1:58825385-58825407 TGGGTCCTAAAGAATAATAAAGG - Intergenic
909349674 1:74636805-74636827 GGGGTCTAAAAGGATATTATTGG + Intronic
910731497 1:90402312-90402334 CTGGTGCCTAAGAATATTATTGG - Intergenic
910966966 1:92817715-92817737 GGGGTGCTAATGAAGACTGTAGG + Intergenic
911380984 1:97114329-97114351 GTGGTGCTAAAGAATTTTTTAGG + Intronic
912733948 1:112133592-112133614 GGGATGCTAAAGGATAGTCTAGG + Intergenic
916427496 1:164694920-164694942 GGGCTGCTTAAGGATATTACAGG - Intronic
917146651 1:171899581-171899603 GAGGTGATAAAGAATAATAATGG + Intronic
921564015 1:216694342-216694364 GTGGTGCTGAAGAATACTGTAGG + Intronic
924794194 1:247280728-247280750 GGGGTGTTTAATAATATTCTGGG - Intergenic
1063680709 10:8184915-8184937 GGGGTGCTAAAAAAAATCAGAGG - Intergenic
1065366480 10:24942245-24942267 AGGGTCCTAAAGTATATTGTGGG + Intronic
1072231472 10:93417571-93417593 GTGGTGCTAGAGAACAGTATGGG - Intronic
1073212388 10:101815611-101815633 GGGATGCTAAAGACTTGTATAGG - Intronic
1073275838 10:102310646-102310668 GGGGTGATAAAGAACAGTCTTGG - Intronic
1075987227 10:126798338-126798360 TGGTTGCTAAAGAATGTTTTCGG - Intergenic
1080407116 11:31989013-31989035 AGGGTGCTAAACAATATGAATGG + Intronic
1083407500 11:62468460-62468482 AGGTTGCTAAATAAAATTATAGG + Intronic
1090048046 11:123353257-123353279 GGGGTCCAAAAGGATATTTTGGG + Intergenic
1090847453 11:130542820-130542842 GGGGTGTTAAAAAATTTAATTGG + Intergenic
1096519880 12:52178977-52178999 GGGGTGCTCAGGAATATCACTGG + Intronic
1101635165 12:106534863-106534885 GGAGTGCTAAAGAGTACTGTTGG + Intronic
1102702626 12:114852770-114852792 GGGCTGCTGAGGAATATTGTGGG - Intergenic
1103705879 12:122872052-122872074 GGGGTGGTAGAAAATATTAAGGG - Intronic
1104106358 12:125663509-125663531 TTGGTGCTACAGATTATTATGGG + Intergenic
1104445870 12:128833100-128833122 AGAGTTATAAAGAATATTATGGG + Intergenic
1107592866 13:41926657-41926679 GGGATGGTAAAGCATATTACAGG + Intronic
1109369501 13:61403463-61403485 CAGGTGCTAAAAAATACTATTGG - Intergenic
1109776312 13:67045278-67045300 GGGATGGTAAAGAATAAAATAGG - Intronic
1112139959 13:96629846-96629868 GGGGAGCTAATGAATAAAATTGG - Intronic
1114919720 14:27311555-27311577 GTTGTGCTAAACAATATAATTGG + Intergenic
1120691414 14:87597450-87597472 GGGGTGATGAAGAACATTCTAGG - Intergenic
1121652372 14:95568384-95568406 TGGATGCTCAAAAATATTATTGG + Intergenic
1133581246 16:7146603-7146625 GGAGTGCTGAAGAATATGCTGGG - Intronic
1133668470 16:7994432-7994454 TGGCTTCTAAAGAATATCATAGG + Intergenic
1134131655 16:11654400-11654422 GGTGCCTTAAAGAATATTATGGG - Intergenic
1135107245 16:19660898-19660920 GGGGAGATACAGCATATTATTGG - Intronic
1143901156 17:10175908-10175930 GGAGTGCTCAAGAATACCATGGG - Intronic
1149049849 17:52291566-52291588 CCTGTGCTAAAGAATATTAGGGG - Intergenic
1149052209 17:52319131-52319153 GGTGTGAAAAAGAATATTCTTGG - Intergenic
1149337383 17:55649868-55649890 AGGGTCCTAAAGAAGAATATGGG + Intergenic
1149394925 17:56230639-56230661 GTGGTCCTAAAGAATATGAGCGG - Intronic
1156644070 18:39138672-39138694 GGGGAGCTAAAGGATAATAGAGG - Intergenic
1158852000 18:61503839-61503861 AGGGGGCTAAAGAATATAACAGG + Intronic
1162340355 19:10087958-10087980 GGGCTGTTAAAGAGTATAATAGG + Intronic
926401000 2:12496604-12496626 GGGTTGCTATAGAAGAATATTGG + Intergenic
928758041 2:34548950-34548972 GAGGTTTTAAAGAATATTTTTGG - Intergenic
930168321 2:48225434-48225456 TGGATCCTAAAGAATATTACAGG + Intergenic
933306876 2:80611663-80611685 GGGTAGCTAAAAAATATTAAAGG - Intronic
944184228 2:196929387-196929409 TGGGTGCTAAAGAACATCAAAGG + Intergenic
946962629 2:225001081-225001103 GGGATGCCAAACATTATTATGGG + Intronic
1168918342 20:1509975-1509997 AGTGTGCTTAAGAAGATTATGGG + Intergenic
1170754163 20:19183763-19183785 GGGGTGCTAAAAAAATTTAATGG - Intergenic
1174221628 20:48960090-48960112 GTTTTGCGAAAGAATATTATGGG + Intronic
1175048080 20:56126065-56126087 GATGTGCTAAAGGCTATTATGGG - Intergenic
1178220305 21:30649803-30649825 GGGGTGCTAAAGTAAATAGTAGG - Intergenic
1181787444 22:25237407-25237429 GGAGTGCTCAAGAAGTTTATAGG - Intergenic
950043399 3:9934124-9934146 GGTCTGATAAAGAATATTAGGGG - Intronic
951551185 3:23876725-23876747 AGGGAGCTAAATAATATTAATGG + Intronic
955078775 3:55638497-55638519 GTGGTTCTTAATAATATTATTGG + Intronic
965443250 3:168742889-168742911 GGGGAGCAAACGAAGATTATGGG - Intergenic
966437459 3:179904735-179904757 TGGGTGCTTAACAGTATTATGGG + Intronic
967662430 3:192129601-192129623 GGGGTTTTAAAGAATATCAGGGG + Intergenic
967902891 3:194475068-194475090 GGGATGCTAGGGAATAATATAGG + Intronic
969668820 4:8578256-8578278 GGGCTGCTAAGGAATTTCATAGG + Intronic
972323230 4:37991884-37991906 GGGGTGACAAAGAATATTCCAGG + Intronic
973749635 4:54001217-54001239 GAGGTGCTAAAGAATAGCATGGG - Intronic
978021721 4:103823048-103823070 GTGTTGGTAAATAATATTATGGG + Intergenic
991012756 5:61901106-61901128 GGGGTGCTAAACACTTTTAAAGG - Intergenic
991524293 5:67539364-67539386 GGGGTTGAAAAGAATATTTTAGG - Intergenic
994109297 5:95982214-95982236 GGAGTGATAAAAAATAGTATTGG - Intergenic
994813984 5:104559929-104559951 GGATTGCTAAAGACTATCATTGG + Intergenic
994989474 5:106980112-106980134 GAGGTGATAAAAAAGATTATAGG - Intergenic
995777037 5:115734755-115734777 AAGGTACTCAAGAATATTATTGG - Intergenic
997389004 5:133498066-133498088 GGGGTGCTAAAGAATATTATGGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1004024999 6:11809790-11809812 GTGATGCTTATGAATATTATGGG + Intergenic
1004862416 6:19818515-19818537 TGGGTGCTAAATAATATTGTGGG - Intergenic
1005942683 6:30572407-30572429 AAGGTGCTTAAGAATGTTATGGG + Intronic
1008664051 6:53698308-53698330 GTTGTGCCAAAGAGTATTATTGG - Intergenic
1012887847 6:104865387-104865409 AGGGTGATAAAGAATATTCTTGG + Intergenic
1013673537 6:112431816-112431838 GGGGAGCTAGAGAATATTTACGG + Intergenic
1016918061 6:149263754-149263776 GAATTGCTAAAGAATATTATGGG + Intronic
1016928175 6:149374544-149374566 GGGGTGCTAAACAGTAATACTGG - Intronic
1017237658 6:152133665-152133687 GGGGTCTTATAGAATATTTTTGG - Intronic
1020665760 7:11040316-11040338 GGGGTGCTGAAGAAAATAAATGG + Intronic
1022997310 7:35770094-35770116 GGAGTGCTAAAAAAAATAATGGG + Intergenic
1026462010 7:70622578-70622600 GGATTGCTAAAGAACATTCTTGG - Intronic
1027721971 7:81754756-81754778 GGGGTGCTAAAGAAAAGCAGGGG - Intronic
1031502490 7:122536788-122536810 AGGGTGCTAATGAAGATTAAGGG + Intronic
1033894510 7:146054424-146054446 AGGGTGCTAAGGGAAATTATGGG - Intergenic
1042617309 8:70664032-70664054 GGTGGGCTAGAGAGTATTATTGG - Intronic
1043220204 8:77653022-77653044 TGGGTGGTCAAGAATATTGTGGG - Intergenic
1044990135 8:97788583-97788605 GAGGTGCAAAAGAAAATGATGGG - Intronic
1045139074 8:99259405-99259427 GGGTTGCCAAAGAACATTAGGGG - Intronic
1045398974 8:101792208-101792230 GGGGTGCTACAAAATATAAATGG + Intronic
1045550105 8:103163857-103163879 TGGGTGCTGAAGAATATTTGTGG - Intronic
1047947494 8:129896461-129896483 GAGGTGGTAAAGAGTATTGTGGG - Intronic
1048792081 8:138113351-138113373 GGGTTGATCAATAATATTATTGG + Intergenic
1060136098 9:121155622-121155644 TGTGGTCTAAAGAATATTATCGG - Intronic
1185758040 X:2667765-2667787 GGGGTGATAAGGAATTTCATGGG + Intergenic
1186014753 X:5178828-5178850 GAGATTCTAAAGAAGATTATTGG - Intergenic
1193305089 X:79940128-79940150 GACGTGCAAAAGAATAATATTGG - Intergenic
1195376029 X:104229149-104229171 CGGTTGCTAACGAATGTTATTGG - Intergenic
1199493041 X:148422396-148422418 GGGTTGCTAAAGAAGATTTATGG + Intergenic