ID: 997392877

View in Genome Browser
Species Human (GRCh38)
Location 5:133531339-133531361
Sequence CAAGGTGACCACAGAGATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997392877_997392882 8 Left 997392877 5:133531339-133531361 CCCTAATCTCTGTGGTCACCTTG 0: 1
1: 0
2: 1
3: 15
4: 214
Right 997392882 5:133531370-133531392 GGACCCACATCATGAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997392877 Original CRISPR CAAGGTGACCACAGAGATTA GGG (reversed) Intronic
900716049 1:4144774-4144796 GACGGTGATCACAGTGATTATGG - Intergenic
902392756 1:16115862-16115884 GAGGGAGACCACAGAGATAAAGG - Intergenic
904768517 1:32868629-32868651 CAAGTGGAACACAGAAATTAAGG - Intronic
910305844 1:85762985-85763007 CAATGTAACCACATAGAATAGGG + Intronic
910447531 1:87313766-87313788 CAAGGTGAGAAGAGACATTAAGG - Intergenic
912152300 1:106875243-106875265 AAAGATGAAGACAGAGATTAAGG - Intergenic
913219028 1:116644636-116644658 CAAGGTGACAGCAGAGAGGATGG + Intronic
913297791 1:117338327-117338349 CTAGGTGAAAAAAGAGATTAAGG + Intergenic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
914335249 1:146709049-146709071 CAAATTCAACACAGAGATTACGG - Intergenic
914848212 1:151294411-151294433 TAAGCTGACCACAGAGTTTGTGG - Exonic
916355253 1:163898787-163898809 CAATAGGACCACATAGATTAAGG + Intergenic
916628135 1:166582031-166582053 AGAAGAGACCACAGAGATTAAGG - Intergenic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
918069573 1:181125043-181125065 TAAGGAGACCTCAGAGATGATGG - Intergenic
918569876 1:185977059-185977081 TCAGGTAACCACAGAGATCAGGG - Intronic
920338923 1:205263198-205263220 CATGGAGACCAGTGAGATTAAGG + Intronic
920536875 1:206743083-206743105 AAAGGAGGCCACAGAGATTAGGG + Intergenic
920922403 1:210309180-210309202 CAATGTGAAGACAGAGATTGGGG - Intergenic
1063629672 10:7722088-7722110 CAAAGAAAGCACAGAGATTACGG + Intronic
1065860355 10:29867380-29867402 CAAGGTGTCCCCAGAGCTAAGGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1067346003 10:45439670-45439692 CCAGGTCACCACAGAGCTTGGGG + Intronic
1069054757 10:63832906-63832928 CAAGATGCCCTCAGAGATTAAGG - Intergenic
1069749717 10:70737369-70737391 CAAGGTCACCACAGTGATCAAGG - Intronic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1076299092 10:129411171-129411193 CATGATGACAACAGAGATGACGG - Intergenic
1077961418 11:7080033-7080055 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1080281841 11:30566325-30566347 CAATGTGACCCTAGAGATTTGGG - Intronic
1080284260 11:30590362-30590384 TTAGGTCAACACAGAGATTATGG - Intergenic
1080566478 11:33514054-33514076 CAAGGTTACCTCAGAGAGAAAGG + Intergenic
1080889240 11:36394901-36394923 CAAAGTGACCACTGATTTTAGGG + Intronic
1081051992 11:38353197-38353219 AATGGTGCCCACACAGATTATGG - Intergenic
1081351135 11:42053702-42053724 CAACTTGGCCAGAGAGATTAGGG - Intergenic
1082916010 11:58438213-58438235 CAAGGTTACCACAGAGCTGATGG - Intergenic
1083071501 11:59988412-59988434 CTAGCTGGCTACAGAGATTAAGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084503111 11:69546481-69546503 CAAGTGGCCCACAGAGAGTAAGG + Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085440710 11:76560010-76560032 AGAGGTGACCACGGAGATGATGG - Intergenic
1086150910 11:83609662-83609684 CAAGGTTGGCAGAGAGATTAAGG - Intronic
1086223462 11:84478761-84478783 CAAAGTGTCAAAAGAGATTAAGG + Intronic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1087717814 11:101629368-101629390 GATGGTGCCCACAAAGATTAAGG + Intronic
1090628069 11:128623106-128623128 CAAGGTGACCTCTCTGATTACGG - Intergenic
1091222599 11:133937966-133937988 AAAGGAGACCACAAAGATGAAGG + Intronic
1095844080 12:46727477-46727499 CATGGTGCCCACCCAGATTAAGG + Intergenic
1097628538 12:62031226-62031248 GATGGTGACCACCCAGATTAAGG - Intronic
1098470903 12:70842600-70842622 CAATGTGACCACAGAGGCAAAGG - Intronic
1098693287 12:73518266-73518288 CAGGATGACTGCAGAGATTATGG - Intergenic
1098997106 12:77133503-77133525 AAAGGTGAGTACAGAGACTATGG + Intergenic
1099690018 12:85940023-85940045 GATGGTGCCCACACAGATTAAGG - Intergenic
1104241836 12:126997605-126997627 CATGGTGCCCACTCAGATTAAGG - Intergenic
1104934677 12:132358106-132358128 CCACGTGGCCACAGAGATGACGG + Intergenic
1105264844 13:18806681-18806703 CAAGGGGAAAACAGAGAGTAGGG + Intergenic
1105668620 13:22588146-22588168 CAAGGTGATCTGAGGGATTAGGG - Intergenic
1106051551 13:26194889-26194911 GAAGGTGCCCACCCAGATTAAGG + Intronic
1106119982 13:26852154-26852176 CAAGGTGACCGCAGGGTTTGGGG + Intergenic
1106916641 13:34522507-34522529 CAAGGTCACCTCAGATATTAGGG - Intergenic
1107183879 13:37494682-37494704 CAAGGTGTTGACAGACATTAAGG - Intergenic
1108133361 13:47328045-47328067 CCAGTTGACCACAGAGATAAGGG - Intergenic
1108735394 13:53278570-53278592 GATGGTGCCCACACAGATTAAGG + Intergenic
1108736119 13:53284760-53284782 CAAGGAAACCACAGAGACTGAGG - Intergenic
1108927705 13:55773753-55773775 GATGGTGCCCACTGAGATTAAGG - Intergenic
1109202556 13:59446895-59446917 CAAGCTGATCACATAAATTAGGG + Intergenic
1110781477 13:79470747-79470769 CAAGATGAAGACAGAGATCAGGG + Intergenic
1112105607 13:96236203-96236225 GAAGGTGCCCACCCAGATTAAGG + Intronic
1112578497 13:100658503-100658525 GAAGGGGACCACAGAGAACAGGG + Intronic
1112875773 13:104036698-104036720 GATGGTGCCCACACAGATTAAGG + Intergenic
1113348964 13:109509344-109509366 GAATCTGACCACAGACATTAGGG + Intergenic
1113915248 13:113867025-113867047 TAAAGTGACCACAGAAAGTATGG - Intergenic
1116559106 14:46355144-46355166 AAAGGGGACCAAAGAGATTTTGG + Intergenic
1116912942 14:50490705-50490727 CAAGGTGACCCCAGATACTAAGG - Intronic
1117720720 14:58626382-58626404 CAAGGTGACAGAAGAAATTATGG + Intergenic
1118819010 14:69333049-69333071 CAAGGTGAGGACAGAGCTCAGGG - Intronic
1120544997 14:85800461-85800483 CATATTGACCACAGAAATTAGGG - Intergenic
1120746646 14:88158645-88158667 CAAGGTCTACACAGAGAGTATGG - Intergenic
1121214595 14:92237636-92237658 TAAGGTGACCACTGAGAGAATGG - Intergenic
1121406749 14:93723712-93723734 TAAGGTGACCACTGAGAGAAGGG - Intronic
1121840669 14:97131204-97131226 CAAGGTAACCACAGATAATCTGG - Intergenic
1123876994 15:24633424-24633446 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1126212974 15:46120593-46120615 CCAGGTGGCCACAGGGCTTATGG + Intergenic
1127092991 15:55484897-55484919 AATGGTGACCACCCAGATTAAGG + Intronic
1128775979 15:70320964-70320986 AAAGGTGACCCCAGTGATGAGGG + Intergenic
1129716522 15:77854901-77854923 CAGTGGGACCACAGAGATAAAGG - Intergenic
1130263539 15:82378564-82378586 GAATTTGACCAAAGAGATTAGGG + Intergenic
1130277755 15:82491090-82491112 GAATTTGACCAAAGAGATTAGGG - Intergenic
1130470081 15:84218275-84218297 GAATTTGACCAAAGAGATTAGGG - Intergenic
1130477569 15:84332842-84332864 GAATTTGACCAAAGAGATTAGGG - Intergenic
1130494196 15:84455288-84455310 GAATTTGACCAAAGAGATTAGGG + Intergenic
1130592370 15:85222903-85222925 GAATTTGACCAAAGAGATTAGGG - Intergenic
1133875089 16:9726509-9726531 AAAGGTTACCACTGAGGTTAGGG - Intergenic
1133885919 16:9827590-9827612 ACAGGTGACCACAAAGATTGAGG + Intronic
1138399754 16:56735851-56735873 AGAGGTGGCCACAGAGAGTAGGG + Intronic
1140119701 16:72072949-72072971 CAGGGAGAACACAGAGAGTAAGG - Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141314203 16:82945252-82945274 CAAAGTGTCCACAGACAATATGG + Intronic
1143007858 17:3848463-3848485 TAAGGTGACCACAAAGAGCAAGG - Intergenic
1144114250 17:12071046-12071068 GAAGAAGACCATAGAGATTACGG - Intronic
1149600760 17:57891640-57891662 CCAGGTGGCCACAGAGAGTTAGG - Intronic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1153612599 18:6901562-6901584 CAGGAAGACCACAGAGATAAAGG - Intronic
1155409050 18:25522019-25522041 CAAGGAGACCTCTGAGAATAAGG - Intergenic
1160023574 18:75200665-75200687 AAGGGAAACCACAGAGATTAGGG - Exonic
1163066393 19:14799387-14799409 CAAGGTGACCACTGAGAGGTGGG + Exonic
1168127518 19:54294182-54294204 CAAAGAGACCACAGAGGTCAGGG + Intergenic
1168581397 19:57558634-57558656 CAAGGAGACCAAAGAGACTCTGG + Intronic
925693680 2:6551738-6551760 CAAGGTGACCACAGGCATCCTGG - Intergenic
926251950 2:11159746-11159768 CCAGGAGACCACAGGGATTCCGG + Intronic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
928717117 2:34073951-34073973 CAAAGGGACCATAGAGATTATGG - Intergenic
930105858 2:47638798-47638820 CAAGATGACCACACTGATTTGGG + Intergenic
930702739 2:54475438-54475460 CCATGTGACCACAGAGAGAAGGG - Intronic
935353488 2:102176868-102176890 CCAGGTGACCTCAGGGATAAAGG - Exonic
936973721 2:118198804-118198826 GAAGATGAAGACAGAGATTAGGG - Intergenic
940071391 2:149692195-149692217 GAAGGTGAAGGCAGAGATTAGGG + Intergenic
942245165 2:174001163-174001185 AAAGTTGAAAACAGAGATTAAGG - Intergenic
942774516 2:179565092-179565114 CAAGGTGAATACAATGATTAAGG - Intronic
942850021 2:180473282-180473304 CAAGGTGCCAACAGAGATCATGG - Intergenic
944896130 2:204166797-204166819 AAAGGTGAACACAGAGAGAAAGG - Intergenic
947439396 2:230105180-230105202 CACGGTGACCACCCAGATTGAGG + Intergenic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1169218219 20:3805418-3805440 CACGGTTCCTACAGAGATTAGGG - Exonic
1170848341 20:19981265-19981287 GAAGGTGACCTCAGAGGTGAAGG + Intronic
1171951051 20:31422878-31422900 CAAGGTAACCAAACAGATGAGGG + Intergenic
1173570746 20:44074491-44074513 AACGGGGACCAGAGAGATTAAGG - Intergenic
1174712935 20:52726550-52726572 CAAGGTGACAAAAAAGATAATGG - Intergenic
1175219063 20:57406585-57406607 GGCGGTGACCACAGAGATGATGG - Intronic
1175659101 20:60796982-60797004 GAAGGTGAAGACAGAGATCAGGG + Intergenic
1175966180 20:62661281-62661303 CAGGGTCACGACAGAGGTTAGGG - Intronic
1176370354 21:6058573-6058595 CCAGGTGACCACTGAGAGCAAGG - Intergenic
1178960702 21:37062135-37062157 GAAAGTGACCACAGAGAGCAGGG + Intronic
1179753165 21:43479968-43479990 CCAGGTGACCACTGAGAGCAAGG + Intergenic
1180820320 22:18822692-18822714 CAAGGTGACGGCAGAGAGGATGG + Intergenic
1181013602 22:20056140-20056162 CAAGGTGCCCACAGACCATAAGG - Intronic
1184075783 22:42176640-42176662 AAACGTGACCACAGGCATTATGG + Intronic
1184354548 22:43970256-43970278 CAAGGTGACTTCAGAGAACAAGG - Intronic
1203220375 22_KI270731v1_random:38259-38281 CAAGGTGACGGCAGAGAGGATGG - Intergenic
1203270450 22_KI270734v1_random:48567-48589 CAAGGTGACGGCAGAGAGGATGG + Intergenic
949174512 3:1043233-1043255 GATGGTGACCACCCAGATTAAGG + Intergenic
950568906 3:13788009-13788031 CAAGGCGACCTCAGAGGTAATGG + Intergenic
950796082 3:15511748-15511770 CCAGATGACCACAGAGAATCTGG + Intronic
950928600 3:16767290-16767312 CAAGGTAAGCTCAGAGATTTGGG + Intergenic
951044619 3:18024324-18024346 CAAGGTGACTGCAGTGATTCAGG + Intronic
952067666 3:29591579-29591601 CAATGAGGCCACAGAGAATAAGG - Intronic
956868568 3:73393393-73393415 CGAGGTGAGCACAGAAATTGAGG + Intronic
960323521 3:116266486-116266508 ACAGGAGACCACAGAGAATATGG + Intronic
965446697 3:168781955-168781977 CATGGTGCCCACCCAGATTAAGG + Intergenic
965616074 3:170593830-170593852 CAAGCTGACCACAGAGCTAGGGG - Intronic
965958244 3:174397358-174397380 GATGGTGCCCACACAGATTAAGG - Intergenic
966044018 3:175528425-175528447 GATGGTGACCACCAAGATTAAGG + Intronic
966651475 3:182305681-182305703 CAAGGTGACCAAAAACATTCTGG + Intergenic
966974181 3:185070528-185070550 CCAGGTGACCTCAGAGTTCACGG + Intergenic
971149542 4:24017009-24017031 CAAAGTGTCTACAGAGATTAGGG + Intergenic
972720055 4:41687395-41687417 CAAGGAGAGCCCAGAGATAAAGG - Intronic
973728150 4:53796422-53796444 CAATGTGACCACAGAGACAGAGG + Intronic
975327898 4:73080720-73080742 CAGAGTGAACACAGAGGTTAAGG - Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975875196 4:78828074-78828096 CATGGTGCCCACACAGATTGAGG - Intronic
976109305 4:81654048-81654070 GAAGGTGACTACAGAGACAATGG + Intronic
978373367 4:108051152-108051174 CAAGGTGACCCCATGGAATAAGG - Intronic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980395680 4:132212109-132212131 CGAGGTGACCACAGAGATCAAGG - Intergenic
982823531 4:159974250-159974272 GAAGATGAGTACAGAGATTAGGG - Intergenic
983151848 4:164293955-164293977 GATGGTGACCACCCAGATTAAGG - Intronic
986595655 5:9419109-9419131 CTAGGTGAACACAGAAATTAAGG - Intronic
986680847 5:10231585-10231607 AAAGGTGACCTCTGAGGTTAGGG - Intronic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987152670 5:15057686-15057708 CTAGGTGACCACAGAAACTTAGG - Intergenic
987982515 5:25104735-25104757 CAAGGTAAACACAGAGAGTCAGG + Intergenic
988079503 5:26398921-26398943 GATGGTGCCCACTGAGATTAAGG + Intergenic
988234268 5:28520601-28520623 GATGGTGTCCACTGAGATTAAGG + Intergenic
988338280 5:29935196-29935218 CAAGCTGACCACTGAGCTCAAGG + Intergenic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
989486066 5:41993897-41993919 GATGGTGCCCACACAGATTAAGG + Intergenic
990924028 5:60998652-60998674 CAGGATGATCACAGAGATTAGGG - Intronic
991118320 5:62980465-62980487 CAAAGAAACCAGAGAGATTATGG + Intergenic
992930950 5:81644525-81644547 CAAGGAGACCACAGAATTTAAGG + Intronic
993571960 5:89551863-89551885 CAAGGTCCACACAGTGATTAGGG - Intergenic
994748885 5:103713651-103713673 CAGGCTGACCTCAGAGATCATGG - Intergenic
996491520 5:124103561-124103583 CAAGGTGTCCACATAGAATGAGG + Intergenic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
1000639338 5:163683014-163683036 CAATGAGACCTCAGAGAGTAAGG - Intergenic
1001271983 5:170319677-170319699 CAAAATGACCACAGACCTTAGGG - Intergenic
1003833540 6:10041697-10041719 CAAGGTGTCTATAAAGATTAAGG - Intronic
1003954073 6:11146035-11146057 CAAGGTGGCCACAGAAAACATGG - Intergenic
1005467525 6:26130038-26130060 CAAGGTGCCAACATAGTTTATGG + Intronic
1010033157 6:71290004-71290026 CAATGTGACCACAGGGTTTTGGG + Intronic
1012900829 6:105004182-105004204 GATGGTGACCACCCAGATTAAGG + Intronic
1013448611 6:110256631-110256653 CAAGGTGATCACAGAGGTGGAGG - Intronic
1015601938 6:134918732-134918754 CACGGTGATAACAGACATTAAGG - Exonic
1019810307 7:3160299-3160321 GATGGTGACCACGCAGATTAAGG - Intronic
1022744267 7:33154019-33154041 CAATGTGAGCACATAGATGAGGG - Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1026490345 7:70857635-70857657 AAAGGCAGCCACAGAGATTAGGG + Intergenic
1028008531 7:85610834-85610856 CAATGTGAACACATGGATTAAGG + Intergenic
1029201856 7:98844568-98844590 CAAGTTGACCTCACAGATGAAGG + Intergenic
1031717850 7:125130740-125130762 CAAGGTGATGGCAGAGATAATGG + Intergenic
1034359626 7:150482928-150482950 CAAGGTTACCACAGAGTTGGGGG - Intergenic
1034756653 7:153628017-153628039 CAAGGTGATGACAGATATTGTGG + Intergenic
1037946621 8:22993577-22993599 AAGGGAGACCAGAGAGATTAAGG + Intronic
1038769695 8:30466042-30466064 CAAGGTGATCACAAAGTTTTTGG - Intronic
1039580280 8:38660393-38660415 GAAGCTGCCCACAGACATTATGG + Intergenic
1039745033 8:40417459-40417481 GATGGTGACCACACAGATTGAGG + Intergenic
1040733441 8:50477356-50477378 GAAGGGGACCACAGAAATAAAGG - Intronic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1042647265 8:71001080-71001102 CAAGGTGATCACAAACTTTATGG + Intergenic
1044099431 8:88114786-88114808 CAAGATAACCTCAGAGTTTAAGG + Intronic
1044800288 8:95946609-95946631 GATGGTGCCCACCGAGATTAAGG - Intergenic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1047191814 8:122685232-122685254 CCAGGTGACCCCAGAGATAGTGG - Intergenic
1051085716 9:13346719-13346741 CTAGGGGACCTCAGAGATCAAGG + Intergenic
1057265948 9:93617888-93617910 GATGGTGCCCACACAGATTAAGG + Intronic
1057614733 9:96579210-96579232 CAACGTGACTACAGGGAATAGGG + Intronic
1061385405 9:130286643-130286665 CAAGGTGGCCCCAGAGACTGTGG + Intronic
1062608165 9:137357994-137358016 GACGGTGCCCACTGAGATTAAGG + Intronic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186789824 X:12986052-12986074 AAAGGTGCCCACCCAGATTAAGG - Intergenic
1188646159 X:32569777-32569799 CAGGGTGATCCAAGAGATTATGG - Intronic
1189193063 X:39127835-39127857 CATGGAAAACACAGAGATTAAGG + Intergenic
1189287435 X:39861466-39861488 CAAGGTGACCCAAGGGATTGGGG - Intergenic
1191675532 X:63788450-63788472 GAGAGTGAACACAGAGATTATGG - Intergenic
1191941644 X:66487391-66487413 GATGGTGACCACCCAGATTAAGG + Intergenic
1192030284 X:67503946-67503968 CAAGGTAACCACAAAGAGAAAGG + Intergenic
1195865964 X:109433034-109433056 CAAAGTGGGCACAGAGATTCTGG - Intronic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1198132768 X:133715082-133715104 AATGGTGCCCACAGAGATTGAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1202108681 Y:21398741-21398763 CAAGGTGAATAAAGAGTTTAAGG - Intergenic