ID: 997393814

View in Genome Browser
Species Human (GRCh38)
Location 5:133540165-133540187
Sequence TGGCAAATCCAGAATCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393814 Original CRISPR TGGCAAATCCAGAATCTGAT GGG (reversed) Intronic
903386196 1:22928564-22928586 TAGCACATCCAGAATCCGTTGGG + Intergenic
904197903 1:28799773-28799795 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
904460089 1:30671443-30671465 TGGCAAGTCCAAACTCTAATGGG - Intergenic
904920577 1:34004867-34004889 TGGCAAGTCCAGAGCCAGATGGG - Intronic
905230532 1:36512415-36512437 TGGCAACTCCAGAAACAGCTTGG + Intergenic
905391902 1:37641372-37641394 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
905982241 1:42239996-42240018 TGGCAAATCCTAAATCTTAAGGG - Intronic
906735590 1:48123632-48123654 TGGCAAATCCGAAATCTGCAGGG - Intergenic
907187696 1:52623020-52623042 TAGAAAATCCAGAATCCGACAGG + Intergenic
909636329 1:77820639-77820661 TGGCAAATACAGGATCAGAAAGG - Intronic
909972463 1:82006956-82006978 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
910442428 1:87266389-87266411 TAGCAAATCCAAAATCTGCAGGG + Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911508114 1:98779121-98779143 TCCCAACTCCAGAATCTTATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
912096690 1:106153259-106153281 TGGCAAATGCGGCATCTGTTTGG - Intergenic
912200050 1:107446672-107446694 TGGGTAATCCAGAATCTCTTGGG - Intronic
912731851 1:112114153-112114175 TGGCAAATCCAAAATCTTCAGGG + Intergenic
912972527 1:114297414-114297436 TGGCAAGTCCACAATCTGTATGG - Intergenic
913519755 1:119633458-119633480 TGGCAAGTCCAAAATCTGTAGGG + Intronic
914949332 1:152098447-152098469 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
916979801 1:170121747-170121769 TGGCAAGTCCAAAATCTGGAAGG - Intergenic
918286882 1:183065342-183065364 TGGCAAGTCCAAAATCTGTGGGG + Intronic
918828577 1:189360437-189360459 TGGCAAATCCACAGCCTGTTAGG + Intergenic
919466829 1:197930494-197930516 TAGGAAATCCACAATCTAATTGG - Exonic
919656468 1:200201742-200201764 TGGCAAATCCAAAATGTGTAGGG - Intergenic
920820118 1:209372589-209372611 TGGCAAATCCCAAATCTGCAAGG + Intergenic
922595620 1:226810662-226810684 TGAGAAATGCAGAATGTGATGGG + Intergenic
922813842 1:228434929-228434951 AGAGAAATCCAGCATCTGATTGG - Intergenic
1063209788 10:3869645-3869667 TGGTGAGTCCAAAATCTGATGGG + Intergenic
1063548996 10:7010804-7010826 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1064337494 10:14457192-14457214 TGGCAAGTCCAAAATCTGCCGGG - Intronic
1064969358 10:21048642-21048664 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1065300677 10:24318490-24318512 TGGCAAATCCACAATCTGCTGGG - Intronic
1065373389 10:25012587-25012609 TTGCAAGTCCAGATTCTAATAGG - Intronic
1065905757 10:30249626-30249648 TGGTGATTCCAAAATCTGATGGG - Intergenic
1066076799 10:31887131-31887153 TGGCAAATCTACAATCTGCAGGG + Intronic
1068464219 10:57367303-57367325 TCACAAATGCAGAATCTGAAAGG - Intergenic
1069183836 10:65397107-65397129 TGGCAAATCAAAAATCTGCAGGG + Intergenic
1069255524 10:66327344-66327366 TTGCAAATCCTAAATTTGATAGG + Intronic
1069967567 10:72133977-72133999 TGGCAAATCCAAAATTAGAAGGG + Intronic
1070448508 10:76532829-76532851 TGGGAAAACCAAAATCTGAATGG + Intronic
1073668389 10:105559442-105559464 AGGCAAATCCAGAGCCTGAGAGG - Intergenic
1075296563 10:121281521-121281543 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
1075785275 10:125045223-125045245 TGGCAGATCCAGGATCTGGGAGG - Intronic
1077321124 11:1942530-1942552 TGGGAAATCCAGGATGGGATGGG + Intergenic
1077764876 11:5147549-5147571 TGGCAAATCCAAAATCTGCAGGG - Intergenic
1077816223 11:5688168-5688190 TGGCAAATCCAAAGTCTGCAAGG + Intronic
1077901399 11:6492343-6492365 TGGTAAATCCAAAATCTGTAGGG - Intronic
1078077689 11:8176520-8176542 TGGCAAATCCAGACTCTGCAAGG - Intergenic
1078817550 11:14841258-14841280 TGGCAAATCCAAAATCTGCAGGG - Intronic
1079361397 11:19773316-19773338 AGGCAGATCCAGACTCTGAGGGG + Intronic
1080741320 11:35066914-35066936 TGGCAAATGCAGACTCATATGGG + Intergenic
1081630956 11:44689365-44689387 TGGCAAATCCAGCAGCTCAATGG + Intergenic
1085577738 11:77621959-77621981 TGGCAAGTCCAAAATCTGCATGG - Intronic
1086124622 11:83337573-83337595 TCTAATATCCAGAATCTGATAGG + Intergenic
1086373711 11:86179589-86179611 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1086774872 11:90817999-90818021 AGCCAAATCCAGAAACTGAAAGG - Intergenic
1087010869 11:93512945-93512967 TGGCACATCTAGAAGCTGAAAGG + Intronic
1087232275 11:95679576-95679598 TGGGAAATCCAAAATCTGCAGGG - Intergenic
1088015134 11:105049340-105049362 TGCCACATCCAGAATTTAATAGG + Intronic
1088234557 11:107708464-107708486 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1088924889 11:114291761-114291783 TGGCAAATGCAGAAACTCACTGG - Intronic
1088942184 11:114470674-114470696 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1093101343 12:15033575-15033597 TGGCAAATCAAAAATCTTACAGG - Intergenic
1094164803 12:27432165-27432187 TTGCAAATCATGTATCTGATAGG - Intergenic
1094309965 12:29069485-29069507 TGGCAAATCCAAAATATGCCAGG + Intergenic
1094354657 12:29565100-29565122 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1095190555 12:39252850-39252872 TGGCAAATCCAAAGTCTTCTGGG - Intergenic
1095731814 12:45513726-45513748 TGGCAAGTCCAAAATCTGCATGG - Intergenic
1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG + Intergenic
1097599157 12:61670460-61670482 ATGCAAATCCAAAATCTAATAGG + Intergenic
1098305369 12:69097304-69097326 TGGCAAATCCAAAATCTTCAGGG + Intergenic
1099996522 12:89785253-89785275 TGGCCACTCCAGATTCTGGTTGG - Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1100840715 12:98609356-98609378 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
1101360165 12:104018927-104018949 AGGCAAATCCAGGTTCTGATGGG + Intronic
1101698216 12:107146907-107146929 TGGTGAGTCCAAAATCTGATAGG - Intergenic
1101901118 12:108792044-108792066 TAGCAAATTGAGAATCTGTTGGG - Intronic
1102442886 12:112977232-112977254 TGGCAAATCCAAAATCGGCAGGG + Intergenic
1102774923 12:115510224-115510246 TGGCAAGTCCATAATCTGGAGGG - Intergenic
1103688011 12:122747803-122747825 TGGCAAGTCCCAAATCTGAAGGG - Intergenic
1104377656 12:128278991-128279013 TGGCAAGTCCAAAATCTGTAGGG - Intronic
1104598852 12:130139014-130139036 TGGCAAATCCAAAATCTATAAGG + Intergenic
1105782837 13:23719542-23719564 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1106451523 13:29886805-29886827 TGGCAAAGGCAGAATTTGAATGG - Intergenic
1106999550 13:35527248-35527270 TGGAAAATGCACCATCTGATCGG + Intronic
1107313934 13:39110799-39110821 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1108665532 13:52626111-52626133 TGGAAGATCTAAAATCTGATAGG - Intergenic
1109570513 13:64182816-64182838 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
1110279984 13:73681846-73681868 TGTCAAGTCCAAAATCGGATGGG + Intergenic
1110384287 13:74890712-74890734 TGGTGAGTCCAAAATCTGATGGG - Intergenic
1110895541 13:80746895-80746917 TGGCACAACCAAAGTCTGATGGG + Intergenic
1111186850 13:84748717-84748739 TGGTAAGTCCAAAATCTGATCGG - Intergenic
1111191400 13:84812114-84812136 TGGCAGATCAAAAATCTGGTTGG - Intergenic
1111297961 13:86308058-86308080 TGGCAAATCCAAAATCTTTACGG - Intergenic
1111471323 13:88686203-88686225 TAGCAAATCCAAAATCTGTAAGG + Intergenic
1111620165 13:90715084-90715106 TGGCAATTCCAGATTCTGCAGGG + Intergenic
1112600522 13:100850969-100850991 TGGCAGATTCAGTGTCTGATGGG - Intergenic
1115257734 14:31420538-31420560 CGGCAATTCCAGACTCTGCTAGG - Exonic
1115699718 14:35939956-35939978 GAGCAAATCCAGAATCATATTGG + Intergenic
1115714186 14:36084646-36084668 TGGCAAATCCAAATTCTGCAGGG - Intergenic
1116024743 14:39501548-39501570 TGGCAGATACAGTACCTGATAGG + Intergenic
1116194205 14:41701668-41701690 AGGGAAATGCAGAATGTGATAGG + Intronic
1117297886 14:54395645-54395667 TGGAGAGTCCAAAATCTGATGGG - Intergenic
1118204664 14:63711470-63711492 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1118903352 14:70004628-70004650 TGGCAAATCTAAAATATGTTGGG - Intronic
1120909301 14:89651252-89651274 TGTCAGATTCAGAATCTGCTGGG - Intergenic
1121960869 14:98258261-98258283 TGGCAAGTTCAGAGTCTGGTGGG + Intergenic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1122912125 14:104835890-104835912 TTGCAAATCCTATATCTGATAGG - Intergenic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1124499314 15:30212820-30212842 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1124744265 15:32325842-32325864 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1124846350 15:33295002-33295024 GGAAAATTCCAGAATCTGATGGG + Intergenic
1125755855 15:42064400-42064422 TGGTGAGTCCAGAGTCTGATGGG + Intergenic
1127385088 15:58460588-58460610 TGGGAAACCCAGGCTCTGATGGG + Intronic
1129818301 15:78576045-78576067 TTGCAAATCATGTATCTGATAGG - Intronic
1130845739 15:87743424-87743446 TGGCAAATTCAGTTTCTGGTAGG - Intergenic
1131153023 15:90058789-90058811 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1131452348 15:92553565-92553587 TAGCAAGTCCAAAATTTGATGGG - Intergenic
1132297496 15:100751657-100751679 TGGCATGTCCAGAATCTGCAGGG + Intergenic
1134202657 16:12211640-12211662 TGTCAACTCCAGAATCTGCAGGG + Intronic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1135067446 16:19322424-19322446 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1137558401 16:49487911-49487933 TGGCAAAGCCAGAAGCTGCCAGG - Exonic
1137895233 16:52205142-52205164 AGGCAGATCAAGAACCTGATAGG + Intergenic
1138824368 16:60301084-60301106 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1138926694 16:61600310-61600332 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1138964503 16:62068025-62068047 GGCCAAGTCCAAAATCTGATGGG + Intergenic
1140405534 16:74708510-74708532 TGCCAAAGCCAGCATCTGCTTGG + Intergenic
1140593162 16:76377034-76377056 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1143990441 17:10955305-10955327 TGCCAATTCCAGAATGTTATTGG + Intergenic
1144243770 17:13341376-13341398 TCTCAAATCCAGATTGTGATGGG + Intergenic
1144311799 17:14020697-14020719 TGGCAATTGCAGAATCTAGTCGG + Intergenic
1144332959 17:14240620-14240642 TGGCAATTGCAGAATCTAGTCGG - Intergenic
1144402819 17:14922794-14922816 AGGCAGATGCAGAATTTGATGGG + Intergenic
1144498052 17:15762647-15762669 ATGCAAGTCCAGAATCTGGTAGG - Intergenic
1144542929 17:16162714-16162736 TGGCAAATTCAGTATTTGTTTGG - Intronic
1145161424 17:20577682-20577704 ATGCAAGTCCAGAATCTGGTAGG - Intergenic
1145354256 17:22124398-22124420 TATCAAATCCAGAATCTCAACGG - Intergenic
1146546558 17:33743780-33743802 TGGCAATTCCAAAATCTGCAGGG - Intronic
1150648179 17:66992869-66992891 GGGCAGATCCAGATTCTGTTGGG - Intronic
1150841425 17:68610620-68610642 TGGCAGATCCAGTGTCTGATGGG + Intergenic
1150936444 17:69640915-69640937 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1151170288 17:72239874-72239896 TGGTGAGTCCAAAATCTGATGGG - Intergenic
1153518750 18:5931843-5931865 TGGCAAAACAAGGATCTCATGGG + Intergenic
1153910081 18:9699009-9699031 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1154163555 18:11997449-11997471 TAGAAAATTCAGAATGTGATAGG - Intronic
1155234701 18:23807562-23807584 TGGCAAGTCCAAAATCTGCAAGG + Intronic
1155981525 18:32185140-32185162 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1156055437 18:32997503-32997525 TGGCAAATCCAAAATCTTCAGGG - Intronic
1156241097 18:35254892-35254914 AGGCAATTTCAGATTCTGATAGG + Intronic
1156393618 18:36676695-36676717 TTGTCAATCCATAATCTGATAGG + Intronic
1157318557 18:46615799-46615821 TGGCAAATACAGAATCATAGTGG - Intronic
1157471181 18:47990232-47990254 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1157669646 18:49517546-49517568 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1158166979 18:54551355-54551377 TGGCAAATGCAAACTCTTATAGG - Intergenic
1158701467 18:59752112-59752134 TGACAAATCCACAATCTGCAGGG - Intergenic
1159723662 18:71925715-71925737 TGTCATATCCAGAATCTGTAAGG + Intergenic
1166341134 19:42137900-42137922 TGGCAATTCCAGGATCAGAAAGG + Intronic
1167180502 19:47899604-47899626 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
925094763 2:1187495-1187517 TGAGAAATCCAAAATCTGAAGGG - Intronic
925166790 2:1720504-1720526 TGGCAAGTCCAGAGTCTGCAGGG + Intronic
926441410 2:12892638-12892660 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
927431154 2:23027167-23027189 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
929347390 2:40902570-40902592 TGGAAAATCCAAATTATGATGGG + Intergenic
930481357 2:51952299-51952321 GTGCAAGTCCACAATCTGATAGG + Intergenic
931202188 2:60108563-60108585 TTGCAAATCATGTATCTGATAGG - Intergenic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
933310579 2:80656802-80656824 TTGCAAATCAAGTATCTGATAGG + Intergenic
933600836 2:84328386-84328408 TGGGGAATCCAGAATCTGCAAGG - Intergenic
937098529 2:119251065-119251087 TGGACCATCCAGAATCTGCTTGG - Intronic
939551016 2:143615846-143615868 CAGCAAATTCAGAATCTGTTTGG + Intronic
939697956 2:145351414-145351436 TTGCAATTCCAGAATTTAATAGG + Intergenic
941005431 2:160242376-160242398 TAGCAAATCCAAAATCTGCAGGG + Intronic
941995178 2:171595406-171595428 TGGAAAATCTAGAATCTGCCTGG - Intergenic
943513528 2:188856338-188856360 AGACAAATCAAGAATCTGAAAGG - Intergenic
944314302 2:198268885-198268907 TGGTGAGTCCAAAATCTGATGGG - Intronic
944316062 2:198286930-198286952 TGGCAAGTCCAAAATCTGGAGGG - Intronic
945617200 2:212086768-212086790 TTCCAAATCCAGAAACTGTTAGG + Intronic
946060658 2:216938284-216938306 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
947294843 2:228618829-228618851 TGGTGAGTCCAAAATCTGATGGG - Intergenic
947529804 2:230901588-230901610 TGTCAAAGGCAGAATCTGCTGGG + Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
948141270 2:235673584-235673606 TGGCAAAACCAGACTCTAACTGG - Intronic
1170530523 20:17286941-17286963 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1170544800 20:17426596-17426618 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1170600351 20:17836800-17836822 TGGGAAAGCCAGAGTCTGGTGGG + Intergenic
1172631077 20:36378667-36378689 GGGCAACTCCAGACTCAGATGGG - Intronic
1172865913 20:38097154-38097176 TGGCAAATCCCAAATCTGCTGGG + Intronic
1173613489 20:44387808-44387830 TGGAAAATCTAGATTCTGTTTGG + Intronic
1173896533 20:46555252-46555274 TAGCAAGTCCAAAATCTGATGGG - Intergenic
1174705408 20:52650386-52650408 TGGCAAGTCCAAAATCTGTAGGG - Intergenic
1175145825 20:56895600-56895622 TGCCAAATTCAGAATCTAAGGGG - Intergenic
1176381658 21:6116886-6116908 TCCCAAATCCAAAATCTGAGCGG - Exonic
1177151339 21:17458425-17458447 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1177240728 21:18453476-18453498 TGGCAAATACAAAATCTGCAGGG + Intronic
1177317090 21:19476770-19476792 AGGCAAGTCCAAAATCCGATAGG + Intergenic
1177490326 21:21816368-21816390 TGGCTAATCCACCATCTTATTGG + Intergenic
1178121516 21:29474520-29474542 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1178884320 21:36473390-36473412 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1179140965 21:38724871-38724893 TGGCAAGTCCAAAATCTGTAGGG + Intergenic
1179201216 21:39223098-39223120 TGACAAATCCAAAATGTGAAAGG + Intronic
1179297090 21:40072651-40072673 TCTCAAATCAAGAATCTGACAGG - Intronic
1179339298 21:40489412-40489434 TGATAAATCCAGAATCTGCAGGG - Intronic
1179741814 21:43421353-43421375 TCCCAAATCCAAAATCTGAGCGG + Exonic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184598433 22:45528127-45528149 TGGCAAGTCCAAAATCTGCAGGG + Intronic
1184938556 22:47742632-47742654 TGGCAAGTTTAGAATCTGTTGGG + Intergenic
950115604 3:10448751-10448773 TCTCAAATCCAGACTCTGGTTGG - Intronic
951466683 3:23007911-23007933 TGGAAAATCCTCCATCTGATAGG - Intergenic
951966166 3:28388006-28388028 TGGCAAATCCAAAATATGGTGGG + Intronic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
952189116 3:31003445-31003467 TGGCAAGTCCAAAATTTGAGGGG + Intergenic
952231032 3:31431457-31431479 TAGCAAGTACAAAATCTGATAGG + Intergenic
953203052 3:40794918-40794940 TGGCAAATCCAAAATCTGCAGGG + Intergenic
953547746 3:43876153-43876175 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
953722123 3:45365485-45365507 TTGCAAAGCCAGCATCTGACAGG - Intergenic
954383091 3:50230006-50230028 TGCCTAATCCAGAAGCTTATGGG + Intronic
955068333 3:55551583-55551605 AGGTAAATCCAAAATCTGATGGG + Intronic
955121050 3:56058790-56058812 TTGTGAATCCAGAATCTAATGGG - Intronic
957443038 3:80277372-80277394 TTGCAAATCCAGAATGACATTGG - Intergenic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
959582770 3:107999211-107999233 AGGCAGATCCAGATTCTGTTTGG - Intergenic
959974982 3:112448535-112448557 TAGCAAATCCAAAATCTGCAGGG + Intergenic
960170231 3:114452389-114452411 TGGCAAATCCAGAATTTTCCAGG - Intronic
960528777 3:118740152-118740174 TGGTGAGTCCAAAATCTGATAGG - Intergenic
960757435 3:121031464-121031486 TGGCAAATCCAAAATCTGTAGGG + Intronic
961993080 3:131213111-131213133 TGGCAAGTCCAAAATCTGCAAGG - Intronic
965106668 3:164364334-164364356 TGGCAGATTCAGTATCTGTTGGG - Intergenic
966902420 3:184496338-184496360 TGGCAAGTCCAAAATCTGCAGGG - Intronic
967399214 3:189041777-189041799 TGGCAGTTTCAGAATCTGCTGGG - Intronic
967490067 3:190080209-190080231 AGGCAAACCCAGTATTTGATTGG + Intronic
969094955 4:4725693-4725715 TGGCAAATCCAAAATCTGCTGGG + Intergenic
970698300 4:18704401-18704423 TGGCAGATTCAGTATCTGGTGGG + Intergenic
970872905 4:20836519-20836541 TGGCAAGTCCAAAATCTGTAGGG + Intronic
971662908 4:29443100-29443122 TGGCAAATCCAAAATGTGCATGG - Intergenic
971807474 4:31378554-31378576 TGGCAAATCCAAACTCTGCAGGG + Intergenic
973193940 4:47418267-47418289 TGGCAAGTCCAAAATCTGTCAGG + Intronic
973257223 4:48125778-48125800 TGGCAAGTCCAAAATCTAACAGG + Intronic
974022057 4:56700456-56700478 TAGCAAATCCAAAATCTGCAGGG - Intergenic
974132530 4:57774337-57774359 TAGCAAGTCCAAAATCTGAAGGG + Intergenic
974192660 4:58527163-58527185 TGGCAAATGCAAAATCTGATGGG - Intergenic
974822735 4:67088569-67088591 TGGTAAATCCAAAATCTGCAGGG + Intergenic
975903074 4:79176411-79176433 TGGTGAATCCAAAATCTGATGGG + Intergenic
976121563 4:81789246-81789268 TGGTAAGTCCAGAATCTGCAAGG + Intronic
976753026 4:88469501-88469523 TGGCAAGTCCAAAATCTGTAGGG + Intronic
980188249 4:129490216-129490238 TGCCAATTCCAGAATCTGCAGGG - Intergenic
981172301 4:141638495-141638517 TGGCAACTCCAGAACCTGATTGG + Intronic
982314041 4:154013032-154013054 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
983145070 4:164203379-164203401 TGGTAAATCGAAAATCTAATGGG + Intronic
985485953 5:149608-149630 TGGCAAATTATGTATCTGATAGG + Intronic
985671736 5:1210312-1210334 GGGCTACTCCAGAATCTGAGGGG - Intronic
985802042 5:2010840-2010862 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
986803675 5:11287385-11287407 TGGCAAGTCCAAAATCTGCAGGG - Intronic
987112599 5:14701418-14701440 TGGCAAATCCCGAGTTTGACAGG - Intergenic
987280223 5:16406330-16406352 TGGTAAATCCAAAATCTGCAGGG + Intergenic
987661379 5:20882626-20882648 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
987803391 5:22728679-22728701 CGGCAAATCCAGTGTCTGTTAGG + Intronic
988762206 5:34322699-34322721 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
990054485 5:51554497-51554519 TGGTAAATCCAAAATCTGCAGGG - Intergenic
991354984 5:65759514-65759536 TGGAAAGTCCAGAATCTCAGTGG + Intronic
992669759 5:79047447-79047469 TGGCAAATCAGAAATGTGATTGG - Intronic
992762963 5:79967886-79967908 GAGCAAATCCAGAAGCTGAGAGG + Intergenic
992925998 5:81587900-81587922 TGGCAAGCCCAGAAAATGATTGG - Intronic
993013962 5:82514561-82514583 TGGTGAGTCCAAAATCTGATGGG - Intergenic
993937720 5:94024377-94024399 CAGCGAATCCAAAATCTGATGGG - Intronic
994252760 5:97556147-97556169 TTGCAAATCCATAATATGGTAGG - Intergenic
994540970 5:101096633-101096655 TGACAAATCCAAAATCTGTAGGG - Intergenic
994746297 5:103682485-103682507 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
994804470 5:104426390-104426412 TGGTGAGTCCAAAATCTGATGGG - Intergenic
996286260 5:121796732-121796754 TGGCACATCCAAAATCTGGAGGG + Intergenic
996425223 5:123306625-123306647 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
996851215 5:127954879-127954901 TGGCAAACCCAAAATCTGTAAGG + Intergenic
997391151 5:133517700-133517722 TGGCAAGTCCAAAATCTGCAGGG + Intronic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
998127344 5:139633593-139633615 TGGTATATCCAGAATCAGATGGG + Intergenic
999470826 5:151853612-151853634 TTGCAAATCATAAATCTGATGGG - Intronic
1000846250 5:166284396-166284418 TGGCAAACCCATAATCTGTGTGG - Intergenic
1002451624 5:179322245-179322267 TGGGAATGCCAAAATCTGATGGG + Intronic
1003413100 6:5883197-5883219 TGGCTAATACAGATTGTGATAGG + Intergenic
1006095645 6:31654882-31654904 TGGCAAATCATCAATCTTATAGG - Intronic
1007238438 6:40407780-40407802 TGGCAGATCCATAATTTCATGGG + Intronic
1007299660 6:40857252-40857274 TGGTCAATCCAGAAGCTCATGGG - Intergenic
1007909961 6:45503637-45503659 TGGCATATCCTGAATCTCAACGG - Intronic
1008486863 6:52046016-52046038 GGGCAAATCCCCAATCTGAGTGG + Exonic
1008609039 6:53169018-53169040 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1010942514 6:81935182-81935204 TGGCAAATCCAAAATCTGCAGGG - Intergenic
1012099300 6:95010524-95010546 TGGTAAATCTAGAATCTGTAGGG + Intergenic
1012622275 6:101360303-101360325 TTGCAAATCAAAAATCTGTTAGG - Intergenic
1012860941 6:104558784-104558806 TGGGAAATTGAGAATCTGAGTGG - Intergenic
1014136745 6:117898123-117898145 TGGTAAATCCAAAATCTGCAAGG - Intergenic
1014361667 6:120484434-120484456 TGGCAAGTCCAAAATCTGCTGGG - Intergenic
1014578362 6:123102675-123102697 TGGCAAGTCCACAATCTGCATGG - Intergenic
1015217804 6:130770093-130770115 TGGCAAGTCCAAAATCTGTAAGG - Intergenic
1015886379 6:137922672-137922694 GGCCAAATTCAGAATCTCATGGG - Intergenic
1017529730 6:155277178-155277200 TAGTAAATCCAGAATGTGATAGG - Intronic
1017538825 6:155378671-155378693 TACCAAATCCAAAATCTGAATGG - Intergenic
1017587955 6:155947443-155947465 TGGAAAATGCACCATCTGATTGG - Intergenic
1020576294 7:9933253-9933275 TGGCAAATCCAAAATCTGCAGGG - Intergenic
1021412341 7:20342601-20342623 TGGAAATTACAGAATCTGAGAGG + Intronic
1022220489 7:28309153-28309175 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1022455186 7:30552488-30552510 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1023994735 7:45152350-45152372 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1024039302 7:45538102-45538124 TGGCAAGTCCAAAATCTGCAGGG + Intergenic
1026198651 7:68195024-68195046 TGGCAAGTCCAAAATCTGTAAGG + Intergenic
1027446415 7:78278803-78278825 TGGCAAATTTAAAATCTGAAGGG - Intronic
1027830377 7:83169535-83169557 TGGCAAATCTAGAACTTGGTTGG - Intergenic
1028026361 7:85845803-85845825 TGCCAAAACCAGAATTTGTTGGG - Intergenic
1028812452 7:95103138-95103160 TAGCAAATCCAAAATCTGCAGGG - Intronic
1030453407 7:109742725-109742747 TGGTAAGTCCAAAATCTGATGGG + Intergenic
1030999568 7:116398841-116398863 TGATAAATCCAAAATCTGATGGG - Intronic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1034128119 7:148692163-148692185 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1036654431 8:10668163-10668185 TGGCAAGTCCAAAATCTGTAGGG + Intronic
1036941043 8:13052284-13052306 TGGCAAGTCCAAAATCTGCAAGG + Intergenic
1037145659 8:15569182-15569204 TGCCAAATGCAGAAGCAGATGGG - Intronic
1037404541 8:18527754-18527776 CGGCATTTCCAGAATCTGGTAGG + Exonic
1038698816 8:29830378-29830400 TGGCAAGTCCAAATTCTGCTGGG - Intergenic
1039355354 8:36809374-36809396 TAGCAAATACAGAAATTGATGGG + Intronic
1041494851 8:58474365-58474387 TAGCAAAGCCAGAATCTCATAGG - Intergenic
1041901026 8:62982867-62982889 TGACAAACCAAGAATGTGATGGG - Intronic
1042056795 8:64772527-64772549 TGGCAAGTCCAAAATCTGCAGGG - Intronic
1043718670 8:83515818-83515840 TGGAAAATCCATAATTTAATTGG + Intergenic
1044853840 8:96454517-96454539 TGGTAAATCCAAAATCTGTATGG + Intergenic
1044934880 8:97284340-97284362 TGGCATATCCAGGTTCTGTTGGG - Intergenic
1046560486 8:115831202-115831224 TGGCAAAAGCAAAATCTGCTTGG - Intergenic
1047053285 8:121137421-121137443 TGGCAAATTCAGTGTCTGATGGG - Intergenic
1047564801 8:126032194-126032216 TGGCAAATAAAGAAGCTGAGGGG + Intergenic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1048961994 8:139587718-139587740 TGGGAAATCCAGAATCTGCAGGG - Intergenic
1049361503 8:142214333-142214355 TGGCACATCCAGAATCCCCTTGG + Intronic
1049700693 8:144010472-144010494 TGGCAAGTCCAAAATCTGTAAGG + Intronic
1050123043 9:2327591-2327613 TGGCAAATCCAAAATCTGCAGGG + Intergenic
1051652171 9:19338834-19338856 TGGCAAACCCAGAGTCTGAGTGG + Intronic
1051868638 9:21711180-21711202 TGGTAAATCCAAAATCTGCAAGG + Intergenic
1051963660 9:22800043-22800065 TGGCAAATACATAAACTTATAGG + Intergenic
1052281998 9:26743612-26743634 TGGCAAATACAGAAGCAGAGTGG + Intergenic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1055785961 9:79869128-79869150 TGGAAAATCCAGATTCTATTTGG + Intergenic
1055828460 9:80354577-80354599 TGGAAAATCCAGATTCTATTTGG - Intergenic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056537978 9:87547663-87547685 TGGCAAGTCCAGAATTTGCTGGG + Intronic
1056749950 9:89342033-89342055 TTGCAAATCATGTATCTGATAGG + Intronic
1057913791 9:99040350-99040372 TGGCAAATCCAGACCCTCACAGG + Intronic
1057925138 9:99139886-99139908 AGCAAAATCCAGAATGTGATAGG - Intronic
1058761393 9:108136833-108136855 TAGCAAGTCAAGAATCTCATGGG + Intergenic
1059527073 9:115002053-115002075 TGGCAAATCCCAAATCTGCAAGG + Intergenic
1061636360 9:131912105-131912127 TAGGAACTCCAGAATCTAATTGG - Intronic
1186801608 X:13098255-13098277 TGGCAAATCCAGTGTCTGGTGGG - Intergenic
1187690425 X:21860597-21860619 GGGTAAATCCAGAATCAGAGGGG + Intronic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1189363964 X:40374014-40374036 TGGCAAGTCCAAAATCTGCAGGG - Intergenic
1190434460 X:50409700-50409722 TTGCAAATGAAGAATCCGATCGG - Intronic
1192772182 X:74204428-74204450 AGGCAAAAGCAGAATCTGAGGGG - Intergenic
1192781502 X:74297847-74297869 TGGCAAGTCCAAAATCTGCAAGG - Intergenic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1194592509 X:95816621-95816643 CAGCAAGTCCAAAATCTGATGGG - Intergenic
1195733089 X:107985586-107985608 TGGCAAGTCCAAAACCTGAATGG + Intergenic
1196258608 X:113552044-113552066 TGGCAAATCCAAAATCTGCAGGG - Intergenic
1197357690 X:125456811-125456833 TGGTAAGTCAAAAATCTGATGGG + Intergenic
1198977019 X:142347568-142347590 TGGCAAATGCTGAATGTGAAAGG - Intergenic
1201912869 Y:19151294-19151316 TGGCAAAATCTGAGTCTGATGGG + Intergenic
1201918130 Y:19204651-19204673 TGGCAGATTCAGTATCTGGTGGG - Intergenic