ID: 997393982

View in Genome Browser
Species Human (GRCh38)
Location 5:133541799-133541821
Sequence TTCCTTGAGAAGTGGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393982_997393992 15 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393992 5:133541837-133541859 GTGGAAAACCTGGCTGCTAGGGG 0: 1
1: 0
2: 2
3: 13
4: 129
997393982_997393986 -4 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393986 5:133541818-133541840 GGAAGCTTAGTTCCCTTCAGTGG 0: 1
1: 0
2: 0
3: 9
4: 122
997393982_997393990 13 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393990 5:133541835-133541857 CAGTGGAAAACCTGGCTGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 205
997393982_997393991 14 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393982_997393987 5 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393987 5:133541827-133541849 GTTCCCTTCAGTGGAAAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393982 Original CRISPR TTCCTTGAGAAGTGGGGAAA TGG (reversed) Intronic