ID: 997393983

View in Genome Browser
Species Human (GRCh38)
Location 5:133541805-133541827
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393983_997393986 -10 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393986 5:133541818-133541840 GGAAGCTTAGTTCCCTTCAGTGG 0: 1
1: 0
2: 0
3: 9
4: 122
997393983_997393992 9 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393992 5:133541837-133541859 GTGGAAAACCTGGCTGCTAGGGG 0: 1
1: 0
2: 2
3: 13
4: 129
997393983_997393991 8 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393983_997393987 -1 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393987 5:133541827-133541849 GTTCCCTTCAGTGGAAAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
997393983_997393990 7 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393990 5:133541835-133541857 CAGTGGAAAACCTGGCTGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 205
997393983_997393994 25 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393983 Original CRISPR CTAAGCTTCCTTGAGAAGTG GGG (reversed) Intronic