ID: 997393985

View in Genome Browser
Species Human (GRCh38)
Location 5:133541807-133541829
Sequence AACTAAGCTTCCTTGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393985_997393987 -3 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393987 5:133541827-133541849 GTTCCCTTCAGTGGAAAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
997393985_997393994 23 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210
997393985_997393990 5 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393990 5:133541835-133541857 CAGTGGAAAACCTGGCTGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 205
997393985_997393991 6 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393985_997393992 7 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393992 5:133541837-133541859 GTGGAAAACCTGGCTGCTAGGGG 0: 1
1: 0
2: 2
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393985 Original CRISPR AACTAAGCTTCCTTGAGAAG TGG (reversed) Intronic