ID: 997393986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:133541818-133541840 |
Sequence | GGAAGCTTAGTTCCCTTCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 132 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 122} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997393983_997393986 | -10 | Left | 997393983 | 5:133541805-133541827 | CCCCACTTCTCAAGGAAGCTTAG | 0: 1 1: 0 2: 0 3: 8 4: 137 |
||
Right | 997393986 | 5:133541818-133541840 | GGAAGCTTAGTTCCCTTCAGTGG | 0: 1 1: 0 2: 0 3: 9 4: 122 |
||||
997393979_997393986 | 27 | Left | 997393979 | 5:133541768-133541790 | CCTTCCAGATTCATTGTATACTT | 0: 1 1: 0 2: 2 3: 19 4: 221 |
||
Right | 997393986 | 5:133541818-133541840 | GGAAGCTTAGTTCCCTTCAGTGG | 0: 1 1: 0 2: 0 3: 9 4: 122 |
||||
997393982_997393986 | -4 | Left | 997393982 | 5:133541799-133541821 | CCATTTCCCCACTTCTCAAGGAA | No data | ||
Right | 997393986 | 5:133541818-133541840 | GGAAGCTTAGTTCCCTTCAGTGG | 0: 1 1: 0 2: 0 3: 9 4: 122 |
||||
997393980_997393986 | 23 | Left | 997393980 | 5:133541772-133541794 | CCAGATTCATTGTATACTTTTTC | No data | ||
Right | 997393986 | 5:133541818-133541840 | GGAAGCTTAGTTCCCTTCAGTGG | 0: 1 1: 0 2: 0 3: 9 4: 122 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997393986 | Original CRISPR | GGAAGCTTAGTTCCCTTCAG TGG | Intronic | ||