ID: 997393988

View in Genome Browser
Species Human (GRCh38)
Location 5:133541830-133541852
Sequence CAGCCAGGTTTTCCACTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393988_997393994 0 Left 997393988 5:133541830-133541852 CCCTTCAGTGGAAAACCTGGCTG 0: 1
1: 0
2: 4
3: 9
4: 208
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393988 Original CRISPR CAGCCAGGTTTTCCACTGAA GGG (reversed) Intronic