ID: 997393989

View in Genome Browser
Species Human (GRCh38)
Location 5:133541831-133541853
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393989_997393994 -1 Left 997393989 5:133541831-133541853 CCTTCAGTGGAAAACCTGGCTGC No data
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393989 Original CRISPR GCAGCCAGGTTTTCCACTGA AGG (reversed) Intronic