ID: 997393991

View in Genome Browser
Species Human (GRCh38)
Location 5:133541836-133541858
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393984_997393991 7 Left 997393984 5:133541806-133541828 CCCACTTCTCAAGGAAGCTTAGT 0: 1
1: 0
2: 0
3: 4
4: 132
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393983_997393991 8 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393985_997393991 6 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195
997393982_997393991 14 Left 997393982 5:133541799-133541821 CCATTTCCCCACTTCTCAAGGAA No data
Right 997393991 5:133541836-133541858 AGTGGAAAACCTGGCTGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type