ID: 997393994

View in Genome Browser
Species Human (GRCh38)
Location 5:133541853-133541875
Sequence CTAGGGGTGTACATTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997393988_997393994 0 Left 997393988 5:133541830-133541852 CCCTTCAGTGGAAAACCTGGCTG 0: 1
1: 0
2: 4
3: 9
4: 208
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210
997393984_997393994 24 Left 997393984 5:133541806-133541828 CCCACTTCTCAAGGAAGCTTAGT 0: 1
1: 0
2: 0
3: 4
4: 132
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210
997393989_997393994 -1 Left 997393989 5:133541831-133541853 CCTTCAGTGGAAAACCTGGCTGC No data
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210
997393985_997393994 23 Left 997393985 5:133541807-133541829 CCACTTCTCAAGGAAGCTTAGTT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210
997393983_997393994 25 Left 997393983 5:133541805-133541827 CCCCACTTCTCAAGGAAGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG 0: 1
1: 0
2: 4
3: 61
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997393994 Original CRISPR CTAGGGGTGTACATTGCTAC TGG Intronic