ID: 997400861

View in Genome Browser
Species Human (GRCh38)
Location 5:133601119-133601141
Sequence GTTCATTCCCAGTGGGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997400861_997400867 -7 Left 997400861 5:133601119-133601141 CCACGTCCCCACTGGGAATGAAC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 997400867 5:133601135-133601157 AATGAACCTGCTGTGCAGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
997400861_997400866 -10 Left 997400861 5:133601119-133601141 CCACGTCCCCACTGGGAATGAAC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 997400866 5:133601132-133601154 GGGAATGAACCTGCTGTGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 168
997400861_997400872 25 Left 997400861 5:133601119-133601141 CCACGTCCCCACTGGGAATGAAC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 997400872 5:133601167-133601189 CGCTGAAATACCTGATGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 57
997400861_997400870 20 Left 997400861 5:133601119-133601141 CCACGTCCCCACTGGGAATGAAC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 997400870 5:133601162-133601184 CCCTGCGCTGAAATACCTGATGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997400861 Original CRISPR GTTCATTCCCAGTGGGGACG TGG (reversed) Intronic
900281542 1:1872777-1872799 GTTCATTCTCTGTGGGGAGATGG - Intronic
900340190 1:2184859-2184881 GTTCATTCCCTTGGGGGAAGCGG - Intronic
900567009 1:3338500-3338522 CTCCTTTCCAAGTGGGGACGGGG + Intronic
900881320 1:5383220-5383242 GGCCATTCCCAGTGGGGCCAGGG - Intergenic
907428916 1:54399356-54399378 GTTAATTCCCAGCTGGGAAGTGG - Intronic
912508732 1:110174237-110174259 GACCATTCCCACTGGGGAAGGGG - Intronic
916174202 1:162024014-162024036 GCTGAGTCCCAGCGGGGACGGGG - Intergenic
916583409 1:166128687-166128709 GTTCTCTCCCAGTGGGAAAGTGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1074772966 10:116745127-116745149 CTTACTTCCCAGTGGGGGCGAGG - Intergenic
1075739859 10:124688373-124688395 GATAATGCTCAGTGGGGACGTGG - Intronic
1076128700 10:127996109-127996131 TGTTATTCCCAGTGTGGACGTGG + Intronic
1076761516 10:132608263-132608285 GAGCATCCCCAGTGGGGCCGTGG + Intronic
1080184713 11:29468223-29468245 GCTCATTTCCCGTGGGGAAGTGG + Intergenic
1083706246 11:64518365-64518387 GTTATTTCCCACTGGGGAAGGGG - Intergenic
1086760055 11:90618181-90618203 GTTCATTACTAGTGGGAATGCGG - Intergenic
1089583960 11:119498255-119498277 ATTCATTACCACTGGGGAGGGGG + Intergenic
1089752422 11:120661035-120661057 GTTCAGTCCCAGCAGGGAGGAGG - Intronic
1090110272 11:123900042-123900064 GTTTCTTCCCAGTGGGCAGGAGG + Intergenic
1094411175 12:30170103-30170125 GGGCATTCGCAGTGGGGAGGAGG - Intergenic
1097434650 12:59542866-59542888 CTTAATTTCCAGTGGGGAAGAGG + Intergenic
1098456619 12:70681478-70681500 ATGCATCCCCAGTGGGGACTAGG - Intronic
1101037168 12:100717257-100717279 GTTCAATCCCCGCGGGGACCCGG + Intergenic
1101183870 12:102251953-102251975 GTACAATCCCAGTGGGTTCGAGG - Intergenic
1103347933 12:120263937-120263959 GTGCTTTCCCAGTGGGAACTGGG - Intronic
1110042890 13:70787748-70787770 GTTCATTTCCAGTTGGAACACGG + Intergenic
1110723019 13:78786880-78786902 GTTCATTCAAAGTGGGGGGGAGG - Intergenic
1110741213 13:78999751-78999773 GTTCTTTCCCAGTGATGATGTGG + Intergenic
1113464957 13:110506517-110506539 GTTCATGCCCACTGGGCACATGG - Exonic
1117043799 14:51792046-51792068 GTTCATTCTCATTGTGGATGGGG - Intergenic
1118044311 14:61950132-61950154 AATCATTCCCAGTGGGGATGTGG - Intergenic
1120917875 14:89725738-89725760 TTTCTTTCCCTGTGGGGGCGAGG + Intergenic
1122939807 14:104976208-104976230 GTTCACTCCCAGTGGGCTCTGGG - Intronic
1127543838 15:59970585-59970607 GTTCATTCCCAGTGCCCATGGGG + Intergenic
1130666552 15:85874239-85874261 CTTCCTTCCCAGTGGGGAGTGGG + Intergenic
1132338544 15:101064090-101064112 GTTCACACCCAGCCGGGACGTGG + Intronic
1139750724 16:69107443-69107465 GTTCCTTCCCGGTTGGGTCGTGG + Intronic
1143151069 17:4807793-4807815 GTTCGTCCCCAGTGGGGAAGAGG - Exonic
1145070667 17:19803727-19803749 GTTCATTACCAGTGGCCACTTGG + Intronic
1155608511 18:27635753-27635775 GTTCTTTCCCAGGAGGGACCTGG - Intergenic
1158195513 18:54881070-54881092 CTTCATTCCCAGTGAGGGGGAGG + Intronic
1160625077 18:80198563-80198585 GTGCCTTCCCAGTGAGGACAGGG + Intronic
1166977982 19:46616183-46616205 CTATATTCCCAGTGGGCACGAGG + Intergenic
926058208 2:9789027-9789049 CTTCATTCCATGTGGTGACGTGG - Intergenic
927667418 2:25042216-25042238 TTTCATTCACAGTCGGGGCGGGG - Exonic
937207448 2:120245765-120245787 GAGCTTTCCCAGTGGGGACCAGG + Intronic
1170467024 20:16631330-16631352 ATTCATTTCCAGTGAGGATGGGG + Intergenic
1171448079 20:25218659-25218681 CTCCATTCTCAGTGGGAACGAGG + Intronic
1174124862 20:48296977-48296999 GTTCTGTCCCTGTGGGGAGGTGG - Intergenic
1176200383 20:63857776-63857798 GCTCATTCCCACAGGAGACGGGG + Intergenic
1180600278 22:17010822-17010844 GTTCATGCCCCGTGGGTAGGAGG + Intergenic
1183063856 22:35350648-35350670 GTTCTCTCCCAGTGGGGAGTAGG - Intergenic
1184549300 22:45196051-45196073 GTTTATTCCCAGTTGGGTAGGGG + Exonic
950261108 3:11543950-11543972 GTTCATGCCCTGTAGGGACTTGG - Intronic
955632632 3:60991078-60991100 GGTCCTTCCTAATGGGGACGGGG + Intronic
957747823 3:84367402-84367424 GTTCAACCCCACTGGGAACGTGG - Intergenic
960736824 3:120790338-120790360 ATTTTTTCCCAGTGGGGAGGTGG + Intergenic
960992591 3:123321720-123321742 CTTCATTCCCAATGAGGACACGG + Intronic
961762841 3:129184109-129184131 GTTCATTCCCAGCTGGGTCCGGG + Intergenic
962484597 3:135830315-135830337 GATTGTTCCCAGTGGGGAAGGGG + Intergenic
963253325 3:143120941-143120963 CTTCATTCCGAGAGGGGACGCGG - Exonic
963398054 3:144757982-144758004 GTTCATTCCCGGTGGGTTCATGG - Intergenic
968440959 4:624173-624195 GTGAATTCTCACTGGGGACGGGG - Intergenic
968452833 4:683239-683261 GTTCCTTCCCCGTGGGGGAGGGG - Exonic
971388370 4:26162136-26162158 ATTCACTCCCAGTGGTGAAGTGG + Intergenic
972277205 4:37568403-37568425 GCCCATTCCCAGTGGAGAAGGGG + Intronic
972446608 4:39150397-39150419 GTTCAGTCCAAGTGGGGGCAGGG + Intergenic
972643570 4:40947013-40947035 CTTCACTCCCTGTGGGGACAGGG - Intronic
992001957 5:72444407-72444429 GATCATTCCCAGTAAGGATGTGG + Intronic
997400861 5:133601119-133601141 GTTCATTCCCAGTGGGGACGTGG - Intronic
997409982 5:133683716-133683738 GTTGATTCCCAGAGGCCACGTGG + Intergenic
999891306 5:155981224-155981246 GTTCAATCTCAGTGGCGACCTGG + Intronic
1004110659 6:12715452-12715474 GTTGATTCCCAGGGGGTAGGTGG - Intergenic
1006086436 6:31598956-31598978 GGTCACCACCAGTGGGGACGTGG + Intergenic
1007753736 6:44085408-44085430 GTACATGCCCTGTGGGGATGGGG - Intergenic
1011112557 6:83853999-83854021 TTACATTCCCAGCGGGCACGAGG + Intronic
1015385664 6:132620234-132620256 GTTCTCTGCAAGTGGGGACGAGG - Intronic
1019385787 7:755323-755345 GTGCGTACCCAGTGGTGACGAGG - Intronic
1020167103 7:5816186-5816208 TTTTTTTCCCAGTGGAGACGTGG + Intergenic
1020713527 7:11639008-11639030 GTTCAAGCACAGTGGGGATGGGG - Intronic
1024669328 7:51577742-51577764 GTTCTTTCTCAGAGGGGAGGTGG - Intergenic
1026294791 7:69041960-69041982 AATCATTACCAGTGGGGAGGGGG - Intergenic
1026742984 7:72990472-72990494 GTTCATTCCCAGGTGGGACAGGG - Intergenic
1026802836 7:73410857-73410879 GTTCATTCCCAGGTGGGACGGGG - Intergenic
1026926092 7:74194935-74194957 GTTCACACCCCGTGGGGACTTGG + Intronic
1027029099 7:74875176-74875198 GTTCATTCCCAGGTGGGACAGGG - Intergenic
1027100751 7:75374606-75374628 GTTCATTCCCAGGTGGGACAGGG + Intergenic
1027156672 7:75773249-75773271 TTTTATTTCTAGTGGGGACGGGG - Intronic
1029321218 7:99762114-99762136 GTTCATTCCCAAAGGGGTGGTGG - Exonic
1034310666 7:150084909-150084931 GTGCAGCCCCAGTGGGGAGGTGG + Intergenic
1034796171 7:154015722-154015744 GTGCAGCCCCAGTGGGGAGGTGG - Intronic
1039301364 8:36212411-36212433 GTTCTTTCCAACTGGGGAAGAGG - Intergenic
1040014633 8:42690502-42690524 GTTCACTCCCGGTGGGTTCGTGG - Intergenic
1044079651 8:87867771-87867793 GGTCACTCACAGTGGGGAAGGGG + Intergenic
1048439208 8:134447589-134447611 GGTCATTCCAAGTGGAGACCTGG + Intergenic
1053822152 9:41979017-41979039 GTTCATCCCCAGGTGGGATGTGG + Intronic
1203695263 Un_GL000214v1:92349-92371 GTTAATATCCAGTGGGGAAGAGG - Intergenic
1203641010 Un_KI270751v1:11714-11736 GTTAATATCCAGTGGGGAAGAGG + Intergenic
1190715904 X:53103404-53103426 GTTCAGTCCCAGTGGGATTGAGG - Intergenic
1191997088 X:67106937-67106959 TTTCATTTCCAGTGGGGCCTTGG - Intergenic
1200116989 X:153773756-153773778 GCCCATGCCCAGTGGGGAGGAGG + Intronic