ID: 997400921

View in Genome Browser
Species Human (GRCh38)
Location 5:133601582-133601604
Sequence GGATGAACAGAGTGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997400914_997400921 10 Left 997400914 5:133601549-133601571 CCCTGGTGGGCAGGGGCATGGGG 0: 1
1: 0
2: 8
3: 61
4: 569
Right 997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG 0: 1
1: 0
2: 2
3: 29
4: 297
997400912_997400921 11 Left 997400912 5:133601548-133601570 CCCCTGGTGGGCAGGGGCATGGG 0: 1
1: 0
2: 3
3: 49
4: 397
Right 997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG 0: 1
1: 0
2: 2
3: 29
4: 297
997400916_997400921 9 Left 997400916 5:133601550-133601572 CCTGGTGGGCAGGGGCATGGGGG 0: 1
1: 0
2: 15
3: 153
4: 1187
Right 997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG 0: 1
1: 0
2: 2
3: 29
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997400921 Original CRISPR GGATGAACAGAGTGTGAGCA AGG Intronic
900789377 1:4669461-4669483 GGATGAAGTGAGTGCAAGCAGGG + Intronic
900927923 1:5717728-5717750 GGATGAATATTCTGTGAGCATGG + Intergenic
901154179 1:7124324-7124346 GGAGGGACAGTGTGTGTGCAGGG - Intronic
901855426 1:12041575-12041597 GAATGAGCCGAGTGGGAGCAGGG + Intergenic
902261978 1:15232784-15232806 GAATCAAGAAAGTGTGAGCATGG + Intergenic
902962844 1:19976991-19977013 GGATGGACAGAGAGGGAGAAGGG - Intronic
902990505 1:20184465-20184487 GGATGACCAGAGTGTGTGAGGGG + Intergenic
903569101 1:24291297-24291319 GAATGCACAGGGTGTGAGCAGGG - Intergenic
903593075 1:24471899-24471921 GGAGAAACAGAAGGTGAGCAGGG + Intronic
904478667 1:30780625-30780647 GGATAAACAAAATGTGACCAAGG + Intergenic
906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG + Intronic
907935591 1:59039236-59039258 GAATGACCACAGTTTGAGCAGGG - Intergenic
909120609 1:71598568-71598590 AGTTGGAGAGAGTGTGAGCAGGG - Intronic
910169978 1:84367385-84367407 GAAGGAACAGAGTGTGCCCAAGG - Intronic
911643652 1:100315927-100315949 GGACAAACAGAGAGTAAGCAAGG + Intergenic
912373167 1:109189230-109189252 GGAAGAACTGAGGGTGTGCAGGG - Intronic
913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG + Intergenic
914715142 1:150248351-150248373 GGATGAACAAAGGCTGGGCACGG - Intergenic
915014690 1:152721753-152721775 GGAGGAAAGGAGAGTGAGCAAGG - Intergenic
919450452 1:197766596-197766618 GAATGAAAAGAGTTTGAGGATGG + Intronic
919913568 1:202126730-202126752 TGATGAATAGAGTGCGGGCATGG + Intronic
920693282 1:208163149-208163171 GGAAGAACAGGGTGTGAGTGTGG + Intronic
921354710 1:214275166-214275188 GGCTGAACAGAGAGGCAGCATGG + Intergenic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922046314 1:221949314-221949336 AGCTGAACCGAGTGTGAGGAGGG - Intergenic
924278629 1:242413176-242413198 GGCTGGTCAGAGTGTCAGCATGG - Intronic
924580655 1:245321133-245321155 GGATGAATAGAGAGAGAACAGGG - Intronic
1063241153 10:4170454-4170476 GGATGGACAGAGTCTCAACAGGG + Intergenic
1064860672 10:19821689-19821711 GGATGGACAAAGTCTTAGCATGG - Intronic
1065982198 10:30910533-30910555 GTATGAAGAGAGTCTCAGCAGGG + Intronic
1067431426 10:46248448-46248470 GGATGAAAACAGTGAAAGCATGG + Intergenic
1067852374 10:49762071-49762093 GGAGGAACAGACTGTGACCTTGG - Intronic
1068072979 10:52219166-52219188 GGATGAATAGATTTTGAGCTGGG + Intronic
1069007704 10:63336774-63336796 AAATAAACAGAGTGTGAGCCAGG + Intronic
1069156316 10:65035028-65035050 GGACAAGCAGAGGGTGAGCAAGG - Intergenic
1069886360 10:71626387-71626409 GGATGGACAGGGTGGGAGCAGGG + Intronic
1069936999 10:71924417-71924439 AGATGAACAAGGTGTGAGCAGGG - Intergenic
1069949826 10:72011117-72011139 GCATGAACGGAGTGTGTGAATGG - Exonic
1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG + Intergenic
1071337495 10:84612639-84612661 GGATGATAAGAGTGGGAGCCTGG - Intergenic
1072341914 10:94460006-94460028 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1072451126 10:95540649-95540671 GGATGAATAGTATGTGAGAAAGG - Intronic
1072750971 10:97978514-97978536 GGAAGAACAGAGAGCAAGCAAGG - Intronic
1073001809 10:100291291-100291313 GGAGGAAGAGAGGGTGAGCTGGG - Exonic
1073596524 10:104805829-104805851 GGAAGAAGAGAGTTTGTGCAAGG - Intronic
1073883059 10:108006348-108006370 GGATCAACAGCCTGTGAACATGG - Intergenic
1075526988 10:123195264-123195286 GGATAAACAGAGTGAGAAAATGG - Intergenic
1076070232 10:127482969-127482991 GGATGAACAGGGAGTGGACAAGG - Intergenic
1076310812 10:129506312-129506334 GGATGAACCGAGGGTAGGCAGGG - Intronic
1076559691 10:131353285-131353307 GGAGGGACAGAGTGGCAGCATGG + Intergenic
1077025106 11:436611-436633 GGGTGAGCAGGGAGTGAGCAGGG + Intronic
1077025116 11:436655-436677 GGGTGAGCAGGGAGTGAGCAGGG + Intronic
1077025140 11:436732-436754 GGGTGAGCAGGGGGTGAGCAGGG + Intronic
1077025164 11:436809-436831 AGGTGAGCAGAGGGTGAGCAGGG + Intronic
1077025181 11:436864-436886 GGGTGAGCAGGGGGTGAGCAGGG + Intronic
1077025206 11:436941-436963 GGGTGAGCAGGGGGTGAGCAGGG + Intronic
1077025210 11:436952-436974 GGGTGAGCAGGGGGTGAGCAGGG + Intronic
1077195720 11:1279037-1279059 GGCTGGAGAGAGTGGGAGCACGG - Intronic
1077586213 11:3455449-3455471 GCAGGAACAGAGTGTAAGAAAGG - Intergenic
1077591984 11:3499441-3499463 GGATGAGCAGAGGATAAGCAAGG + Intergenic
1078267093 11:9763461-9763483 GGCTGGACAGAATGTGAACATGG + Intergenic
1078562511 11:12385386-12385408 TGAGGAACAGAGTGGTAGCAAGG + Intronic
1079719640 11:23793548-23793570 GTCTGCACAGAGTGTGGGCAAGG + Intergenic
1080134325 11:28836710-28836732 GGATGCACAGAGTGGGAACAAGG + Intergenic
1080908558 11:36572049-36572071 AGATGAACATACTTTGAGCAGGG - Intronic
1082699076 11:56405440-56405462 AGATGAACAGAGTGTGTTAAGGG + Intergenic
1083140704 11:60718854-60718876 GGACAACCAGAGAGTGAGCAAGG + Intergenic
1084753312 11:71218597-71218619 GGATGAGCAGCGTGAGGGCAGGG + Intronic
1086198457 11:84170588-84170610 GGATGAGCTGAGTGTGTTCATGG + Intronic
1086305238 11:85472633-85472655 GGATAACCAAAGAGTGAGCAAGG - Intronic
1086814797 11:91356430-91356452 GGATGGATAAATTGTGAGCATGG + Intergenic
1087767578 11:102172954-102172976 GCATGAACAGAGTCTGTGAAAGG + Intronic
1091351654 11:134902628-134902650 AGATGACCAGTGTGTGTGCATGG - Intergenic
1091414302 12:267779-267801 TGATGAACAGTTAGTGAGCAGGG + Intergenic
1092430504 12:8404598-8404620 GGATGAAGAGTGTGGGCGCACGG + Intergenic
1095313275 12:40726467-40726489 GGATGGACTGAGTGCAAGCAGGG + Intronic
1095335892 12:41025833-41025855 GAATGACCAGAACGTGAGCAGGG - Intronic
1096008261 12:48189901-48189923 GGATGAAAGGTATGTGAGCAAGG - Intergenic
1097018001 12:56000652-56000674 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098917186 12:76269675-76269697 GGAAGAATAGAGTGAGAGTAAGG + Intergenic
1099634773 12:85199697-85199719 GGATGGAAAGAGTGCAAGCAGGG + Intronic
1101631544 12:106499870-106499892 GGATGCTGAGAGTGTGATCAGGG + Intronic
1102513506 12:113431297-113431319 GCATGAAAGGAGTTTGAGCAGGG + Intronic
1104013182 12:124946594-124946616 GGAGGAACATAGAGTGAGAAGGG + Intergenic
1105837839 13:24225937-24225959 GGACAAACGGAGGGTGAGCAAGG + Intronic
1107922829 13:45228149-45228171 GGAAGAACGGTGTGTGAGCATGG - Intronic
1107922876 13:45228535-45228557 GGAAGAACGGTGTGTGAGCATGG - Intronic
1108512478 13:51168859-51168881 GGAGGAAGAGAGAGAGAGCAGGG - Intergenic
1110039230 13:70731063-70731085 GTTTTAACAGAGTGGGAGCAAGG - Intergenic
1111358661 13:87145302-87145324 GGATGAAGAAAGTGCAAGCAGGG - Intergenic
1113330250 13:109319569-109319591 GGAGGCACTGAGAGTGAGCAAGG + Intergenic
1116221640 14:42095703-42095725 GGACAAATGGAGTGTGAGCAAGG + Intergenic
1117414363 14:55480073-55480095 GGAAGAACAGGGTCAGAGCAAGG - Intergenic
1117897207 14:60499990-60500012 TAATGACCAGAGTGTGAGGAGGG + Intronic
1118096486 14:62543184-62543206 GCATAAATAGAGAGTGAGCAAGG + Intergenic
1118602736 14:67481950-67481972 AGAGGAGGAGAGTGTGAGCAAGG + Intronic
1119731614 14:76954852-76954874 GGATGGGCAGAGATTGAGCAAGG - Intergenic
1119780705 14:77275258-77275280 GGAGGAACAGAAAGTGGGCAGGG + Exonic
1119883570 14:78121654-78121676 GGATGAACAGACTGTCTCCAGGG + Intergenic
1120297432 14:82661474-82661496 TAATGAACACAGGGTGAGCAAGG - Intergenic
1121309586 14:92928411-92928433 GGAAGAACAGTGTGTTAGCTTGG - Intronic
1122216606 14:100208650-100208672 GGAGGAACCGAGAGCGAGCAAGG + Intergenic
1122419101 14:101564181-101564203 GGATGAAGAGAGAGAGACCAGGG + Intergenic
1122507935 14:102243793-102243815 GGATAAACCAAGTGTGATCAGGG - Intronic
1126194446 15:45916809-45916831 GGATGAACAGAGGGAGAACAAGG - Intergenic
1126933207 15:53677609-53677631 GGAAAAAGAGAGTGTGTGCAGGG - Intronic
1127904102 15:63363539-63363561 AGAGGAACAGAGGGTGACCAAGG - Intronic
1128477030 15:68006171-68006193 AGTTGAACAGAGTGTGAGAGTGG + Intergenic
1135528117 16:23229496-23229518 GGATGAACAGCGGGTGGGAATGG - Intergenic
1136373967 16:29854096-29854118 TGAGGAGGAGAGTGTGAGCACGG - Intergenic
1137520398 16:49190271-49190293 GGATGAACTTAGTGTGTTCAAGG - Intergenic
1137902217 16:52281047-52281069 AGATCAGCAGAGTATGAGCAAGG - Intergenic
1139380862 16:66529806-66529828 GGATGGACAGAGGGACAGCAGGG - Intronic
1139974452 16:70797818-70797840 GGAGCAAAAGAGAGTGAGCAGGG - Intronic
1140519349 16:75567944-75567966 TGATGAACAGAGTGTGGGCAAGG - Intronic
1141013624 16:80426833-80426855 GCTTGAACAGAGTTTGATCAAGG + Intergenic
1141271037 16:82541463-82541485 GGGTGAACATAGTGTCAGAAAGG + Intergenic
1142125719 16:88409342-88409364 GGATGACCAGAGACTGAGCACGG + Intergenic
1142895632 17:2976008-2976030 GGGTGAACAGAGCGTGTTCACGG - Intronic
1143456722 17:7072630-7072652 ACATTTACAGAGTGTGAGCAGGG - Intergenic
1144070396 17:11666395-11666417 GGAAGGACAGAGTGGGACCAGGG + Intronic
1147585917 17:41654042-41654064 GCAAGAGCAGAGTGTGAGGAGGG + Intergenic
1147781607 17:42946979-42947001 AGAAGAACAGAGTGTGTTCAGGG - Intergenic
1152726937 17:81952210-81952232 GGATGCACAGACTCAGAGCAGGG - Intergenic
1153487507 18:5614934-5614956 GTATGAAGAGAGTATGAACATGG + Intronic
1153678798 18:7480518-7480540 GGAGGCCCAGAGTGAGAGCAGGG + Intergenic
1154087355 18:11320451-11320473 AGGTGAAAAGAGTGTGGGCAGGG - Intergenic
1155313066 18:24543912-24543934 GGAAGCACAGTGTGTGAGGATGG - Intergenic
1157196115 18:45621567-45621589 GGAGGAAGCGACTGTGAGCAAGG - Intronic
1158433524 18:57415619-57415641 GTTTGCACACAGTGTGAGCAGGG - Intergenic
1158599289 18:58843366-58843388 GGATTAACAGCGTGGGAGCTAGG - Intergenic
1159820524 18:73136461-73136483 GGATGTAGAGAGTGTGATGATGG + Intergenic
1161267407 19:3370715-3370737 GGAGGAACAGAGAGAGAGGAAGG - Intronic
1163715532 19:18870320-18870342 CGATGACCAGAGAGTGCGCAGGG + Exonic
1165268628 19:34684003-34684025 GCAGGAACAGAGTGTGATAAAGG - Intronic
1165766454 19:38354509-38354531 TCATGGACAGAGTGTGAGCAAGG + Intronic
1166266243 19:41686387-41686409 GGCTGAACTGACTGAGAGCAAGG - Intronic
1167608239 19:50493120-50493142 ACAGGAACAGAGTGGGAGCAGGG + Intergenic
1167890235 19:52534303-52534325 GGATGAACTATGTGTGACCAAGG + Intronic
1167914283 19:52727449-52727471 GGATGAACTATGTGTGACCAAGG - Intronic
1167915569 19:52737349-52737371 GGATGAACTATGTGTGACCAAGG - Intergenic
1167938359 19:52925614-52925636 GGATGAACTATGTGTGACCAAGG - Intergenic
1167994802 19:53393774-53393796 GGATGAACTATGTGTGACCAAGG + Intronic
1168003294 19:53466374-53466396 GGATGAACTATGTGTGACCAAGG + Intergenic
1168409832 19:56132811-56132833 AGATGTTCAGAGAGTGAGCAGGG - Intronic
925617022 2:5753545-5753567 CGCTGACCAGAGTGTGAGCCAGG - Intergenic
925736633 2:6969468-6969490 GCATGAGCAGGGTGTGGGCAGGG - Intronic
927649500 2:24903488-24903510 GGAGGAACAGAGGGTGAAGAAGG - Intronic
928268338 2:29831539-29831561 GGATCAACAGAGTTGGAGCTAGG - Intronic
929119620 2:38473693-38473715 GGATGAAAAGAGGGAGAGCGTGG + Intergenic
929264250 2:39900437-39900459 GGCAGAACAGAGAGAGAGCAGGG - Intergenic
929806582 2:45151559-45151581 GGAGCAAAAGAGAGTGAGCAGGG - Intergenic
931265920 2:60660493-60660515 GGATGTAGAGAGTGTGAGTTGGG + Intergenic
931332435 2:61301672-61301694 GGCTGAACATAGTGTGAGATAGG - Intronic
933506256 2:83180895-83180917 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
933806395 2:86001091-86001113 AGATGGAGAGAGTGGGAGCAGGG - Intergenic
934232930 2:90202372-90202394 GGAGGAACACAGTATGAACACGG + Intergenic
934578611 2:95419816-95419838 AGAGGAACAGAGTGGGGGCAGGG + Intergenic
936500859 2:113065215-113065237 GGACAAAGAGAGTGTGAACAGGG - Intronic
936515530 2:113179093-113179115 AGAGCAACCGAGTGTGAGCAAGG - Intronic
938116496 2:128606157-128606179 GGATGAAGAGAATGTGTGCTGGG + Intergenic
938732511 2:134157831-134157853 GGACAACCAGAGGGTGAGCAAGG + Intronic
938754326 2:134365742-134365764 GCAAGACCAGAGTGTGAGAAAGG - Intronic
940129919 2:150369645-150369667 TGACAACCAGAGTGTGAGCAGGG - Intergenic
940391790 2:153141016-153141038 GGATGGACAGAGTGGTAGAATGG - Intergenic
942778960 2:179617970-179617992 AGAAGAAGAGAGAGTGAGCACGG - Intronic
945732447 2:213555419-213555441 GGATGGACTGAGTGCAAGCAGGG - Intronic
946015869 2:216603322-216603344 GGGTGAATACAGTGTGAGGAAGG + Intergenic
948040655 2:234899028-234899050 GGGAGAACAGAGTGGGAACAGGG - Intergenic
948718741 2:239882955-239882977 GGATGAGCAGATTGTGACAAGGG + Intergenic
1169025911 20:2371280-2371302 GAATGAAAAGATTCTGAGCAAGG + Intergenic
1169880548 20:10341970-10341992 GGACAAACGGAGGGTGAGCAAGG - Intergenic
1170073765 20:12397033-12397055 GGAACAAGAGAGTGTGAGGAAGG + Intergenic
1173831429 20:46091703-46091725 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
1175275657 20:57768823-57768845 GGATGGAGTGAGAGTGAGCAGGG - Intergenic
1175539374 20:59738707-59738729 GGATGAAGGGAGTGTCAGGAAGG - Intronic
1176311560 21:5153535-5153557 GGATGAGAAGTGTGGGAGCAGGG + Intronic
1176883627 21:14228676-14228698 GGATGAAGTGAGTGCCAGCAGGG - Intergenic
1176913685 21:14599349-14599371 GGATGAAGTGAGTGCAAGCAAGG - Intronic
1177112892 21:17049672-17049694 GGACAACCAGAGAGTGAGCAAGG + Intergenic
1177271230 21:18851283-18851305 GGATGAAGGGAGTGCAAGCAGGG - Intergenic
1177926141 21:27217913-27217935 GGATGAACAGAGGATAATCAAGG - Intergenic
1178601266 21:33996794-33996816 GGATGAACAAAGAGAGAGAATGG + Intergenic
1179845490 21:44108500-44108522 GGATGAGAAGTGTGGGAGCAGGG - Intronic
1180172254 21:46065695-46065717 GGGTTAACAGAGAGTGAGCTTGG - Intergenic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1180192394 21:46172191-46172213 GGATGCACAGAGCGTGAGGCGGG + Intronic
1183513148 22:38247699-38247721 GGCTGAACAGAGTGTGGGTTAGG - Intronic
1184745797 22:46455041-46455063 GGAAGAACACAGTGTGAAGACGG + Intronic
1185104232 22:48858178-48858200 GGATGGACAGAGAGAGAGCATGG - Intergenic
1185199654 22:49493961-49493983 GGCTGAACAGCCTGTGAGTATGG + Intronic
949906641 3:8863737-8863759 GTGTGGACAGAGTGAGAGCAGGG - Intronic
951935846 3:28022465-28022487 TGAAGAACAGAGTGTAAGGAAGG - Intergenic
952350479 3:32531429-32531451 GGATGTAGGGAGAGTGAGCAAGG - Intronic
952968934 3:38638442-38638464 GTATGATCAGAGTGTGATCAGGG - Intronic
953126815 3:40098463-40098485 AGATAAACAGAGTGTTAGGAGGG - Intronic
953147413 3:40291255-40291277 GGACAACCAGAGCGTGAGCAAGG + Intergenic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
954088885 3:48269192-48269214 GCATGCACGGAGTGTGGGCAAGG + Exonic
955286812 3:57649766-57649788 GGAGAATCAGAGAGTGAGCAGGG - Intronic
956506858 3:69949904-69949926 GGATGAACAGACTGAGAATATGG + Intronic
956966056 3:74462110-74462132 GGATGAAGAGAGAGTGAGAGGGG - Intronic
957209505 3:77240592-77240614 GGAGGCACTGAGAGTGAGCAAGG + Intronic
957566790 3:81894442-81894464 GGATCCAGAGAGTCTGAGCAGGG + Intergenic
960150773 3:114246601-114246623 GGAGAAACAGAGAGTGAGAACGG - Intergenic
960561722 3:119091702-119091724 GGAAGAAGTGAGTGGGAGCATGG + Intronic
961032555 3:123619230-123619252 GCATGAAGGCAGTGTGAGCATGG - Intronic
961319161 3:126061034-126061056 GGGTCCACAGAGTGTGGGCAGGG + Intronic
961647775 3:128401525-128401547 GCAGCATCAGAGTGTGAGCATGG + Intronic
962294801 3:134173547-134173569 GGATGGAGTGAGTGTGAGCAGGG + Intronic
963679933 3:148361648-148361670 TAATGAACAGAGTATGAGAATGG - Intergenic
965139184 3:164814103-164814125 GGAGGCACACAGAGTGAGCAAGG - Intergenic
965275642 3:166678442-166678464 GGCTGACAAGAGTGTGTGCAGGG + Intergenic
965364750 3:167784627-167784649 GGATGGAGAGAGTGCAAGCATGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968591403 4:1461465-1461487 GGATGAACAGAGGGTGAACAAGG + Intergenic
969196469 4:5567299-5567321 GGGTGAATAGAGTCTGACCAGGG - Intronic
969493185 4:7511555-7511577 GGTTGAAGAGAGAGTGAGCCTGG + Intronic
969736229 4:8992887-8992909 GGATGAGGAGTGTGGGAGCACGG - Intergenic
971792427 4:31185478-31185500 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
971990074 4:33881139-33881161 CAATTAACATAGTGTGAGCAAGG - Intergenic
976058265 4:81095075-81095097 GGATGAGAAGAGAGTGAGAAAGG - Intronic
976978703 4:91196553-91196575 GGATTAACAGAGTATGGGCAGGG - Intronic
977021135 4:91761572-91761594 GGAGCAAGAGAGAGTGAGCAGGG + Intergenic
977393587 4:96445369-96445391 GGATGAAGTGAGTGCAAGCAGGG - Intergenic
978360693 4:107928663-107928685 GCATGAACAGAGAGAGTGCATGG - Intergenic
978417508 4:108492302-108492324 GGATAAAGAAAATGTGAGCAGGG - Intergenic
979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG + Intergenic
979893895 4:126134082-126134104 AGATGAACATAGTGTGTCCATGG - Intergenic
980280208 4:130708484-130708506 GGATGGACTGAGTGCAAGCAGGG + Intergenic
980328381 4:131379216-131379238 GGAGGAGCAGAGAGCGAGCAAGG - Intergenic
981563783 4:146076227-146076249 GGATGAAAAGAGAGTCAGCCAGG + Intergenic
982236312 4:153254066-153254088 TTATGAACAGAGTGTGACTAGGG + Intronic
982703244 4:158679302-158679324 AGATGAACAGAGCCTGAGAAGGG + Intronic
984266080 4:177499525-177499547 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
984918031 4:184741060-184741082 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
987308130 5:16657623-16657645 GGATGAAGAGAATGTGAATAGGG + Intergenic
988338903 5:29943209-29943231 GGATGGAGTGAGTGTGAGCAGGG + Intergenic
988446434 5:31290910-31290932 GAGTGAGAAGAGTGTGAGCAAGG - Intronic
992944799 5:81799593-81799615 GGATGAAAGGAGTCTAAGCAAGG + Intergenic
993606014 5:89991430-89991452 AGATGAACAGAGTGTTAGAATGG - Intergenic
993981107 5:94544769-94544791 TGATGTACAGAGTGTCAGGAAGG + Intronic
995112449 5:108442546-108442568 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
995678837 5:114695308-114695330 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
995756182 5:115506742-115506764 GGATGAAGAGTGAGTGAGAATGG - Intergenic
996372339 5:122766728-122766750 GGATGGACACAGGGTGAACAGGG + Intergenic
996798360 5:127375639-127375661 GGAAGAACAGAGCTAGAGCAGGG - Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997428289 5:133819373-133819395 GGAGGAGCAGGGTGTGAGCAGGG - Intergenic
997758269 5:136420778-136420800 GGAGGGACAGAGTGAGAGGATGG - Intergenic
999431473 5:151528696-151528718 GGATGAAGAGTGTGGGAGTATGG + Intronic
1000574022 5:162953501-162953523 GCATGGAGAGAGTGTAAGCAAGG - Intergenic
1000951788 5:167492991-167493013 TGAAGAATAGAGTTTGAGCATGG + Intronic
1002395378 5:178948605-178948627 GCGGGAACAGAGTGTGGGCAGGG - Intronic
1003256126 6:4476491-4476513 GCCAGAACAGAGTGTGATCAAGG - Intergenic
1005787193 6:29256595-29256617 GGATGAGAATAGTTTGAGCAGGG + Intergenic
1006118063 6:31785748-31785770 GGAGGACCAGAGGGTGAGCCAGG + Intronic
1006380350 6:33693695-33693717 AGATGATCAAGGTGTGAGCAGGG + Exonic
1007227832 6:40327356-40327378 GCAAGGAAAGAGTGTGAGCAGGG + Intergenic
1008517717 6:52333958-52333980 GGATGAAAACACTGTGAGAAAGG + Intergenic
1008690824 6:53976867-53976889 GGATCAAAAGAATGTGAGCCTGG + Intronic
1009031237 6:58060793-58060815 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009207094 6:60815255-60815277 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1012110003 6:95217582-95217604 GGATTAAGAGTGTGTGTGCAGGG - Intergenic
1014641611 6:123917667-123917689 TGATGAACAGAGTGACAGTATGG - Intronic
1017545867 6:155450341-155450363 GACTGAACAGAGTGTGGGGAGGG - Intronic
1017967854 6:159281889-159281911 GGCTGAACAGAGAGGCAGCATGG - Intergenic
1019256526 7:56018-56040 GGATGGAGAGAGTGTGAGTTGGG - Intergenic
1021797266 7:24268826-24268848 GCATGAGCAGAGTGGTAGCAGGG - Intergenic
1022265355 7:28748377-28748399 GGAAGAACAATGTGTGGGCAAGG + Intronic
1023087383 7:36584989-36585011 GGATGCTCAGAGTCTGGGCATGG + Intronic
1023878716 7:44306836-44306858 GAATGAGGAGGGTGTGAGCAGGG + Intronic
1023878759 7:44307013-44307035 GGAAGAAGAGGGTGTGAGCAGGG + Intronic
1024226648 7:47330629-47330651 GGAGGAACAGAGGGAGAGAAGGG + Intronic
1024288347 7:47780261-47780283 GGATGAAAAGACGGTGAGGAAGG - Intronic
1024825500 7:53385669-53385691 GGAGGCACAGAGAGCGAGCAAGG + Intergenic
1026054145 7:66970329-66970351 GGATGGACTGAGTGTGAGGTAGG - Intergenic
1026370120 7:69690865-69690887 GGACAACCAGAGGGTGAGCAAGG + Intronic
1028128951 7:87147545-87147567 GGATAATCGGAGGGTGAGCAAGG + Intergenic
1028516403 7:91682094-91682116 GGATGAAGTGAGTGCAAGCAGGG + Intergenic
1036005079 8:4652974-4652996 GGATGAGCAGTGGGTGAGCAAGG - Intronic
1037676216 8:21052864-21052886 GGAGCAAGAGAGAGTGAGCAGGG + Intergenic
1038805087 8:30783020-30783042 GGATAAACAAAGTGTGGGCCAGG - Intronic
1040701709 8:50074711-50074733 GGAGGCACTGAGAGTGAGCAAGG - Intronic
1043370466 8:79584720-79584742 GGATGAAGTGAGTGCAAGCAGGG - Intergenic
1044457154 8:92401636-92401658 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
1045396016 8:101761380-101761402 GAATGAAGGGCGTGTGAGCATGG + Intronic
1045660126 8:104428601-104428623 GGATGAACAGAGGGTGAGACTGG + Intronic
1046346930 8:112942080-112942102 GGATGAAGAGAGGGTGCACAGGG - Intronic
1047510529 8:125512173-125512195 GGATGCTCAGTGTTTGAGCAAGG + Intergenic
1048008537 8:130438544-130438566 GGATGGGCAGGGTGTGAGCTGGG - Intronic
1048321395 8:133403374-133403396 GGTGGAACAGTGTGTGAGAAGGG + Intergenic
1049039648 8:140102836-140102858 GGGTGAACAGAGTGAGAGGCAGG - Intronic
1050406935 9:5319278-5319300 TGATGAACTGAGGGTGAGCAGGG + Intergenic
1050413844 9:5394237-5394259 TGATGAACTGAGGGTGAGCAGGG + Intronic
1051539826 9:18203129-18203151 GTATAAACAGAGCATGAGCACGG - Intergenic
1051816101 9:21106887-21106909 GACTGAACAGAGTGTGAGCTAGG - Intergenic
1052902589 9:33806538-33806560 AGACGAAAAGAGTGTGAGGATGG + Intergenic
1053061666 9:35036605-35036627 GAATGAACAAACTGTGAGCGTGG - Intergenic
1053122287 9:35556129-35556151 GGCTGAATGGTGTGTGAGCAGGG + Exonic
1053487983 9:38475337-38475359 AGATGAAAAGAGTGTGAGGATGG - Intergenic
1055254102 9:74345526-74345548 GGATGATTAGAGTGTCAGAAAGG - Intergenic
1056097144 9:83266872-83266894 GGATGAAAAGAGAGAGAGGAAGG - Intronic
1057647925 9:96894357-96894379 GGATGATCAGATATTGAGCATGG - Intergenic
1060050631 9:120375949-120375971 AGAAGAAGACAGTGTGAGCATGG + Intergenic
1060659361 9:125394826-125394848 GGATGGAGTGAGTGAGAGCAGGG - Intergenic
1061278645 9:129584363-129584385 TGCTGACCAGAATGTGAGCATGG + Intergenic
1190804981 X:53826658-53826680 GGATAAAGAGAATGTGAGCCGGG + Intergenic
1191802012 X:65092075-65092097 GGATGAAGAGAAAGTGAGAAAGG - Intergenic
1192578388 X:72260774-72260796 GGATGTGGAGAGTGAGAGCAAGG - Intronic
1192739207 X:73876626-73876648 GGATGGGCAGAGTGAGAGTAGGG + Intergenic
1193719911 X:84974747-84974769 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
1193881632 X:86929864-86929886 GGATGAAGTGAGTGCAAGCAGGG - Intergenic
1195037862 X:100986452-100986474 GCATGAACAGAGTTTGGGAAAGG + Intronic
1195460332 X:105116216-105116238 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1196785525 X:119418631-119418653 GGATAAAATGAGTGTAAGCATGG - Intronic
1198380163 X:136076199-136076221 GGAGTGACAGAGTGTGAGAAGGG + Intergenic
1199317611 X:146399549-146399571 GGATGAAGGGAGTGCAAGCAGGG - Intergenic
1199831859 X:151555659-151555681 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
1200016832 X:153171016-153171038 GGATGGAGAGAGTGCAAGCAGGG - Intergenic
1200276903 X:154741814-154741836 GGATGAAGTGAGTGCAAGCAGGG + Intronic
1200791277 Y:7301793-7301815 GCAAGAAGAGAGCGTGAGCAGGG + Intergenic
1200955254 Y:8938190-8938212 GGAGGCACAGAGAGTGAGCAAGG - Intergenic
1201623502 Y:15986826-15986848 GGAGGAAGAGAGAGTGAGGAGGG + Intergenic
1202276448 Y:23125754-23125776 GGAGGAAGAGGGTGTGATCAGGG + Intergenic
1202289580 Y:23294936-23294958 GGAGGAAGAGGGTGTGATCAGGG - Intergenic
1202429442 Y:24759476-24759498 GGAGGAAGAGGGTGTGATCAGGG + Intergenic
1202441349 Y:24910614-24910636 GGAGGAAGAGGGTGTGATCAGGG - Intergenic