ID: 997400994

View in Genome Browser
Species Human (GRCh38)
Location 5:133602234-133602256
Sequence CAAAAGCTACCCTGGAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997400990_997400994 -8 Left 997400990 5:133602219-133602241 CCTGGACTTGGAAGACAAAAGCT 0: 1
1: 0
2: 1
3: 18
4: 180
Right 997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG No data
997400985_997400994 15 Left 997400985 5:133602196-133602218 CCCTTTCCTGAAGCAGCAACATT 0: 1
1: 0
2: 2
3: 21
4: 309
Right 997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG No data
997400988_997400994 9 Left 997400988 5:133602202-133602224 CCTGAAGCAGCAACATTCCTGGA 0: 1
1: 0
2: 0
3: 27
4: 229
Right 997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG No data
997400984_997400994 18 Left 997400984 5:133602193-133602215 CCTCCCTTTCCTGAAGCAGCAAC 0: 1
1: 0
2: 6
3: 28
4: 292
Right 997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG No data
997400986_997400994 14 Left 997400986 5:133602197-133602219 CCTTTCCTGAAGCAGCAACATTC 0: 1
1: 0
2: 1
3: 26
4: 223
Right 997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997400994 Original CRISPR CAAAAGCTACCCTGGAGCAG GGG Intronic
No off target data available for this crispr