ID: 997401486

View in Genome Browser
Species Human (GRCh38)
Location 5:133606613-133606635
Sequence ATGTTTGATAGTAGATAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997401486_997401487 6 Left 997401486 5:133606613-133606635 CCTACTTATCTACTATCAAACAT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997401486 Original CRISPR ATGTTTGATAGTAGATAAGT AGG (reversed) Intronic
902266246 1:15267918-15267940 ATGTTTTATAGCATATAAATAGG + Intronic
902734201 1:18389581-18389603 ATCTTTGATACTAGATAAAAGGG + Intergenic
903290323 1:22309243-22309265 ATGTTTGATAGAAAACATGTCGG + Intergenic
905081501 1:35325305-35325327 ATGTATGATAGAAGATATGATGG + Intronic
906340588 1:44977055-44977077 TTGTTTTATAGTACAAAAGTCGG + Intronic
910041240 1:82853845-82853867 ATATTTGATAGTAAAGAAATTGG + Intergenic
912165918 1:107041959-107041981 ATGTTTGAAAGTATGTGAGTGGG - Intergenic
912905201 1:113698546-113698568 ATCTTAGTTAGTAGAAAAGTAGG - Intronic
912974785 1:114318717-114318739 AAGTTTGACAGCAGATAAGAAGG - Intergenic
913699203 1:121357754-121357776 ATGTTTGAGAGTACGTAAGGAGG + Intronic
914138342 1:144922291-144922313 ATGTTTGAGAGTACGTAAGGAGG - Intronic
915692698 1:157705536-157705558 ATGTTTGTTAGCAGATAACGTGG + Intergenic
917827046 1:178834464-178834486 ATGTTCTATAGTAGCTAAATGGG - Intronic
917999571 1:180479575-180479597 ATGTTTGATAGCAGAGTAGAGGG + Intronic
918816957 1:189198725-189198747 ATATTTGATACTATGTAAGTTGG - Intergenic
919360464 1:196586614-196586636 ATGTTTCATAGTAGAAAATGTGG - Intronic
920486613 1:206376466-206376488 ATGTTTGAGAGTACGTAAGGAGG + Intronic
923817994 1:237401974-237401996 ATGTTTGATAATAAGTAAGTAGG - Intronic
1064455552 10:15484400-15484422 ATGTATGAAAATGGATAAGTTGG - Intergenic
1068207540 10:53875494-53875516 ATGTTTGATTATAGAGAAATTGG - Intronic
1068211231 10:53923680-53923702 ATGTTGGATAATAGTTAACTTGG - Intronic
1071435347 10:85643815-85643837 ATCTTTGTTAGTACATAAGATGG - Intronic
1073671767 10:105598762-105598784 ATGTTTGAAATGAGATTAGTGGG + Intergenic
1079622789 11:22574601-22574623 ATTTGTCATAGTAGATAAGAGGG + Intergenic
1080183875 11:29456124-29456146 ATGTAAGATATTAGTTAAGTGGG - Intergenic
1085339346 11:75721158-75721180 CTGTATGATCGTAGGTAAGTTGG + Intronic
1085521116 11:77139390-77139412 ATATTTGATAGGAGAAAAGCTGG + Intronic
1086194417 11:84120188-84120210 AGGTTTTATAGTTGATAAATGGG - Intronic
1086621830 11:88895342-88895364 AAGTTTGGCAGTAGACAAGTTGG + Intronic
1087355269 11:97085293-97085315 AAGTTTGATAGTACATTTGTGGG + Intergenic
1087512042 11:99108110-99108132 ATGGTTGATTGTAGATTACTTGG + Intronic
1087524033 11:99284821-99284843 CTGCTGGATAGTAGATAAATAGG + Intronic
1087582643 11:100078335-100078357 ATGTTTGGTAATATATAAGCAGG - Intronic
1087736872 11:101843945-101843967 AGGATTGACAGTAGAAAAGTAGG - Intronic
1089075048 11:115731626-115731648 ATGTTTGTTATTAGAGAAGTTGG + Intergenic
1090616283 11:128518316-128518338 ATGTTTGTTAGAAGATAAGGTGG - Intronic
1090906221 11:131076808-131076830 AGGTTTGATAGTAGAGGAGAAGG - Intergenic
1092091340 12:5805936-5805958 TTGTTGGAAAGTAGATAAGCAGG + Intronic
1092913932 12:13172538-13172560 ATGTTTGGTACTAGAGAAATGGG - Intergenic
1094896187 12:35038597-35038619 ATGTTTGATAGGAGAAATCTCGG + Intergenic
1094954108 12:35976580-35976602 ATGTTTGATAGGAGAAATCTCGG + Intergenic
1094977423 12:36352619-36352641 ATGTTTGATAGGAGAAATCTCGG + Intergenic
1095017175 12:36996558-36996580 ATGTTTGATAGGAGAAATCTCGG + Intergenic
1095425543 12:42071044-42071066 AAGTTTGAAAATAAATAAGTGGG - Intergenic
1097671612 12:62546348-62546370 ATGTTAGATTTTAGATAAATGGG - Intronic
1099372350 12:81851227-81851249 ATGAATGATATTAAATAAGTTGG - Intergenic
1099960081 12:89388474-89388496 AATTTTGATAGTAGTTAAGGTGG - Intergenic
1101791934 12:107935418-107935440 AGGTTTCATAGTTGATAGGTGGG - Intergenic
1104500453 12:129280698-129280720 ATGATTGATAGATGATAGGTAGG - Intronic
1107215429 13:37912093-37912115 ATCTTTTAGAGTAGATATGTTGG - Intergenic
1109760635 13:66824033-66824055 ATTTTTGATACAAAATAAGTAGG - Intronic
1110234357 13:73200883-73200905 ATCTCTGATATTAGATAATTAGG + Intergenic
1111180773 13:84661872-84661894 ATGTCTGTTAGGAGATGAGTAGG + Intergenic
1112688339 13:101859648-101859670 GTGTTTGATATTTGTTAAGTAGG + Intronic
1113160299 13:107372733-107372755 ATGTTTGATAACAGATTGGTAGG - Intronic
1120363622 14:83538406-83538428 ATGTCTTATAGTAGAAAAGTTGG + Intergenic
1123481610 15:20637854-20637876 TTGTGTGGTAGTGGATAAGTGGG + Intergenic
1123636403 15:22362511-22362533 TTGTGTGGTAGTGGATAAGTGGG - Intergenic
1124070678 15:26390396-26390418 CTGTTTGATCTTAGACAAGTAGG + Intergenic
1138703504 16:58890375-58890397 ATGTGTGGTAGTAGTTTAGTGGG - Intergenic
1138746772 16:59372226-59372248 AGGTTAGATGGTAGAGAAGTAGG - Intergenic
1141955907 16:87371147-87371169 ATGTTTGATAGGAGATGCCTGGG - Intronic
1145292439 17:21559201-21559223 GTGTTTGAGAGCAGATAACTGGG - Intronic
1151637532 17:75361565-75361587 ATTTTTGCAAGTAGATAACTTGG - Intronic
1158804234 18:60950301-60950323 ATGTTTGATAGTAGAGTAGAAGG - Intergenic
1159753575 18:72334532-72334554 GTGTTTGAGAGTAGAAAAGATGG - Intergenic
1164189622 19:22902047-22902069 ATGTTTGATATTAAATATTTAGG - Intergenic
929550509 2:42887805-42887827 AGTTTTGCTAGTAGATGAGTAGG - Intergenic
933385413 2:81604517-81604539 ATATTTGACAGTGGATAAATGGG - Intergenic
933863940 2:86499153-86499175 ATCTTTGATAGGAGATTAGACGG + Intergenic
935366559 2:102297715-102297737 ATGGTTGATAATAGGTAATTAGG + Intergenic
935841432 2:107115910-107115932 ATGTCTGAAAGTACAGAAGTTGG + Intergenic
936704183 2:115051537-115051559 ATGGTTAATAGTAAATAAATAGG + Intronic
938123575 2:128653861-128653883 ATGTTTTACAGTAGATTATTTGG + Intergenic
939623369 2:144447578-144447600 ATCTTTAATTGAAGATAAGTTGG - Intronic
940389881 2:153119938-153119960 ATGATAGATAGTGGATATGTAGG - Intergenic
940923679 2:159339479-159339501 GTTTTTCATAGTGGATAAGTTGG - Intronic
941513975 2:166448966-166448988 ATGTATGATATTAAATGAGTAGG + Intronic
943796158 2:191998362-191998384 AAGTTTGATATTAGATATTTAGG - Intronic
946721796 2:222616731-222616753 TTTTTTGATAGTAAATATGTTGG - Intronic
947095487 2:226562082-226562104 ATGTTTGGTACTAGAGAAGTGGG - Intergenic
1169656181 20:7926226-7926248 CTGTTTGACAGTAGAGAAGAAGG - Intronic
1169802917 20:9529912-9529934 CTGTTTGATTGTAGCTATGTTGG - Exonic
1179127762 21:38606235-38606257 ATAATTGATAGAAGATAGGTAGG + Intronic
1181660670 22:24345904-24345926 CTGCATGATAGTAAATAAGTAGG + Intronic
1183839929 22:40490825-40490847 AATTCTGATAGTAGATAATTAGG + Intronic
949705570 3:6813090-6813112 ATGTTTTATTGTTTATAAGTTGG + Intronic
949911887 3:8917855-8917877 ATTTTTGATAGTATATAGTTTGG - Intronic
951170226 3:19533264-19533286 ATGTTTAAGAATAAATAAGTAGG + Intronic
951900505 3:27653361-27653383 ATGTTGGAAAGTAGATATGAGGG + Intergenic
953488087 3:43321817-43321839 ATCTTTGATGGAAGATAAGATGG + Intronic
953843095 3:46405704-46405726 ATGTTTGATGGCAGAGGAGTTGG - Intergenic
954568564 3:51621467-51621489 ATGTTTGATAATAAATCTGTTGG + Intronic
954940183 3:54364996-54365018 CTGTCTGATAGGAGATAAATGGG + Intronic
956322928 3:68018756-68018778 ATTTTTGTTACTAGAAAAGTGGG - Intronic
958150822 3:89692516-89692538 ATGTTTCCTAGAAGTTAAGTGGG - Intergenic
958594034 3:96199369-96199391 ATGATGGATAGAAGATAAATAGG + Intergenic
958729371 3:97945065-97945087 ATGTTTGTTAGTAGATACGCAGG + Exonic
958908799 3:99970580-99970602 TAGTTTACTAGTAGATAAGTAGG + Intronic
965037279 3:163456658-163456680 ATGTTTGATACTAGATCTTTGGG + Intergenic
966024296 3:175257416-175257438 GTGTTTAATAGTAGATTAGATGG + Intronic
966243855 3:177784207-177784229 ATGTTTGATATTAGAAAATATGG - Intergenic
969932916 4:10649625-10649647 ATGTTTGAGAGTAGAGAGGTAGG - Intronic
970113515 4:12665189-12665211 ATGATTGGCAGTAGAGAAGTAGG - Intergenic
973992738 4:56426663-56426685 ATGTCTGTCAGTTGATAAGTGGG - Intronic
974066174 4:57079716-57079738 ATGTTGGACAGAAGATAACTGGG - Intronic
974472782 4:62339564-62339586 ATATTTGATATTAGACCAGTTGG - Intergenic
974707334 4:65537570-65537592 ATGTTTAATAGGATAAAAGTAGG - Intronic
975648372 4:76567727-76567749 TTTTTTGATTGTAAATAAGTAGG + Intronic
975918548 4:79355109-79355131 ATGTTTGATAGCAGAGTAGAGGG + Intergenic
976654680 4:87476269-87476291 ATATTTGATAGGAAATATGTGGG - Intronic
976781674 4:88766190-88766212 ATGTTAGATAGGAGAAGAGTAGG + Intronic
977115720 4:93024782-93024804 CAGTGTGATAGTGGATAAGTGGG - Intronic
977116610 4:93036293-93036315 ATTTTTAATACTATATAAGTTGG - Intronic
977140003 4:93358528-93358550 ATGTTAGAAAATAGATAAATGGG + Intronic
977773936 4:100894909-100894931 ATGTTTTATAGAAAATAAGCTGG - Intergenic
977790137 4:101089948-101089970 ATGTTAGATAGTGGATAGGCTGG + Intronic
982715523 4:158803190-158803212 ATGTATCATAGAAGATAATTTGG - Intronic
983633508 4:169874593-169874615 ATGTTTGTTAAAATATAAGTTGG - Intergenic
984344825 4:178509573-178509595 ATGTTTAAAAATATATAAGTAGG + Intergenic
984507344 4:180636244-180636266 GGGTTTTATAGTAGAAAAGTTGG + Intergenic
984732581 4:183082175-183082197 ATTTTTTATAGCAGGTAAGTTGG - Intergenic
986909374 5:12535240-12535262 ATGTTTTACATTAGATAAGTAGG - Intergenic
988194560 5:27986449-27986471 ATGTTAGATTGTATATAAGATGG + Intergenic
989824986 5:45842679-45842701 TGTTTTGATAGAAGATAAGTTGG + Intergenic
995062450 5:107825741-107825763 ATTTTTGATTGTAGAGCAGTTGG - Intergenic
995766164 5:115622224-115622246 AAGTTTGATGGAAGAGAAGTGGG - Intronic
997401486 5:133606613-133606635 ATGTTTGATAGTAGATAAGTAGG - Intronic
998438818 5:142138598-142138620 ATGTTTTATAATAAATAAGGTGG - Intronic
1000583724 5:163067835-163067857 ATGTTAGATTATAGATGAGTTGG - Intergenic
1003551482 6:7106163-7106185 AGGTCTGATATGAGATAAGTAGG - Intergenic
1003758038 6:9144335-9144357 ATGTTTGAGATTTGATCAGTAGG + Intergenic
1003800911 6:9666150-9666172 ATGTAAGATAGTAGAAAAGCTGG + Intronic
1005241812 6:23839034-23839056 ATGTTGGATAGTACTTTAGTAGG + Intergenic
1006968713 6:38017620-38017642 ATATTTGATACTTGAAAAGTTGG + Intronic
1007002726 6:38329645-38329667 ATGTTTTATAGAAGACAACTTGG - Intronic
1010208859 6:73347317-73347339 AGGTTTGATCGTAGTTAATTTGG + Intergenic
1011406798 6:87023718-87023740 TTGTTGGATACTAGACAAGTTGG - Intergenic
1012557861 6:100537756-100537778 ATGCTTCATTGTAGATAATTTGG - Intronic
1015785010 6:136914245-136914267 AATTTTGATATTAGAGAAGTGGG - Intergenic
1017327627 6:153158304-153158326 ATGTATGATTGGAGATAAGGAGG - Intergenic
1018775431 6:167010331-167010353 ATGTGTGAAAGTAGAAAACTGGG + Intronic
1020352394 7:7235394-7235416 ATGTTTGCTAGTTGATAAAATGG - Intronic
1021177663 7:17468670-17468692 ATGTGTGATATCAAATAAGTGGG - Intergenic
1021353566 7:19626748-19626770 ATGTCCTTTAGTAGATAAGTGGG + Intergenic
1022034747 7:26523019-26523041 ATTTCTCATAGTAAATAAGTTGG + Intergenic
1022915391 7:34944679-34944701 ATGTATCATAGTAGATATTTTGG + Intronic
1023255990 7:38313018-38313040 ATGTTTGACTTCAGATAAGTAGG - Intergenic
1023760995 7:43465198-43465220 GAGTTTGATATTAAATAAGTTGG + Intronic
1026416542 7:70187105-70187127 TGGATTGATAGTAGATTAGTAGG + Intronic
1026505967 7:70983433-70983455 ATGTTTGATAGCAGACTAGGGGG - Intergenic
1027862584 7:83603985-83604007 ATTTCTGATAGAAGATAACTTGG - Intronic
1028776508 7:94683425-94683447 ATGGTAGATGGTAGATAAGGAGG + Intergenic
1032886130 7:136140658-136140680 TTGATTGATAGTAGAAAAGGAGG + Intergenic
1037019350 8:13949686-13949708 ATTTTTAATAGCAGATAATTTGG + Intergenic
1037772207 8:21809045-21809067 ATGTTTCAGAGTGGATAAGGAGG + Intronic
1040366444 8:46722310-46722332 CTATTTGATAGTAGAAAAGGTGG - Intergenic
1040700049 8:50052554-50052576 AAATTTAAAAGTAGATAAGTTGG + Intronic
1041863625 8:62542739-62542761 ATGTTTGATTGTAGGTACATGGG - Intronic
1042326115 8:67529627-67529649 ATATTGGATAGAAAATAAGTAGG + Intronic
1042648866 8:71017427-71017449 AGGTTTGAGAGTAGAGAGGTAGG + Intergenic
1042873704 8:73421034-73421056 ATGATTAATAATAGAGAAGTTGG - Exonic
1043176780 8:77031186-77031208 ATGTTTTAAAGTTGATAAGAAGG + Intergenic
1043240041 8:77921349-77921371 AAATTTGAAAGTAGATAATTGGG - Intergenic
1046565521 8:115894419-115894441 ATGTTTGATACTTTATATGTGGG - Intergenic
1047909999 8:129517767-129517789 ATGTTTGATAATTGTTAAATTGG - Intergenic
1053414265 9:37936974-37936996 ATGTTTGAGAGGAGAAAACTGGG - Intronic
1053535376 9:38920345-38920367 ATGTGTGAGAGGAGATGAGTGGG - Intergenic
1054207597 9:62144749-62144771 ATGTGTGAGAGGAGATGAGTGGG - Intergenic
1054630755 9:67443605-67443627 ATGTGTGAGAGGAGATGAGTGGG + Intergenic
1055596855 9:77874298-77874320 AGGTTTCATAGAAGACAAGTTGG - Intronic
1062654284 9:137594418-137594440 ATGTTTGAAAATAGAGAGGTGGG + Intergenic
1185718716 X:2364574-2364596 ATGATAGACGGTAGATAAGTAGG - Intronic
1186111355 X:6260268-6260290 TGGTGTGATAATAGATAAGTGGG + Intergenic
1187095450 X:16143081-16143103 ATGTCTGACAGCAGAAAAGTTGG + Intronic
1188062227 X:25615777-25615799 ATGTATGAGAGGAGATAGGTTGG - Intergenic
1188319174 X:28714193-28714215 AGGTTTTAAAGTAGCTAAGTAGG - Intronic
1188629770 X:32340147-32340169 ATAATTGATAGATGATAAGTAGG - Intronic
1190639690 X:52471862-52471884 ATGTTAGGTAGTAAATAATTTGG - Intergenic
1193129695 X:77906497-77906519 GTGACTGATAGTAGATAACTAGG - Exonic
1197642691 X:128984678-128984700 ATGTTTGATAGCAGAGCAGGGGG - Intergenic
1199517850 X:148698546-148698568 CTTTTTCATAGTAGATAAATAGG - Intronic
1200323918 X:155217445-155217467 AGATTTTATAGTAGCTAAGTGGG - Intronic
1202040742 Y:20680832-20680854 TTGTTTGGTTGTAGAGAAGTGGG - Intergenic