ID: 997401487

View in Genome Browser
Species Human (GRCh38)
Location 5:133606642-133606664
Sequence CAGAGTAAACACACAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997401486_997401487 6 Left 997401486 5:133606613-133606635 CCTACTTATCTACTATCAAACAT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997401487 Original CRISPR CAGAGTAAACACACAGAGCA AGG Intronic
No off target data available for this crispr