ID: 997402110

View in Genome Browser
Species Human (GRCh38)
Location 5:133611659-133611681
Sequence CTACGCACAAGCAGCGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997402106_997402110 1 Left 997402106 5:133611635-133611657 CCGCTCACTCTGGACCGCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 21
997402102_997402110 8 Left 997402102 5:133611628-133611650 CCCCGGGCCGCTCACTCTGGACC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 21
997402098_997402110 30 Left 997402098 5:133611606-133611628 CCTAGACACGTTCAAGCGGGTAC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 21
997402103_997402110 7 Left 997402103 5:133611629-133611651 CCCGGGCCGCTCACTCTGGACCG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 21
997402104_997402110 6 Left 997402104 5:133611630-133611652 CCGGGCCGCTCACTCTGGACCGC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997402110 Original CRISPR CTACGCACAAGCAGCGCCGC AGG Intronic
900431811 1:2606229-2606251 CTACGTACGAGCCGCGCCGGTGG - Exonic
1077021025 11:417220-417242 CCAGGGACAAGCAGCGCCCCGGG + Intronic
1098765424 12:74482561-74482583 CTAGGCACAAGCAACCCTGCTGG + Intergenic
1132631167 16:918260-918282 GTACGAACAAGCCGCGCGGCCGG - Intronic
1132826913 16:1909731-1909753 CTAAGCCCAAGCAGCCCCGGAGG + Intergenic
1133188302 16:4115882-4115904 CTGCGCACAAACAACTCCGCTGG + Exonic
1137582252 16:49640601-49640623 CTTCACACAATCAGCGCTGCGGG - Intronic
1146126516 17:30235681-30235703 CTCCGCACAGCCAGCGCCGCCGG - Exonic
1148487985 17:48003552-48003574 CTGCGCACCAGCAGCCCGGCAGG - Intergenic
1161016663 19:1986818-1986840 CCACGCTCAAGGTGCGCCGCCGG - Exonic
1164615057 19:29662830-29662852 CCACGCACAGCCAGCCCCGCTGG + Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
926054450 2:9766272-9766294 CCACGCAGCAGCAGCCCCGCAGG + Intergenic
950517066 3:13474122-13474144 CTAGGCACGAGCAGAGGCGCCGG - Intergenic
996101851 5:119452530-119452552 ACACGAACAAGCAGAGCCGCTGG - Intronic
997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG + Intronic
1001929720 5:175664311-175664333 CTGAGCACAAGCAGGGCCCCAGG - Intronic
1035263736 7:157677103-157677125 CTACACACAAGGAGGGGCGCAGG - Intronic
1036971425 8:13359463-13359485 CTAACCTCAAGCAGAGCCGCAGG - Intronic
1044839894 8:96328573-96328595 AGAAGCACAAGCAGCGCCACTGG - Intronic
1046131881 8:109975642-109975664 CTGCGCACAACCGGCGCCGCAGG + Exonic
1056801481 9:89695127-89695149 GGACACACAAGCAGGGCCGCGGG - Intergenic
1058983812 9:110193856-110193878 CTACTCACAAGCTGGGGCGCAGG + Intronic
1061502584 9:131012547-131012569 TTACGCACAAGGGGCGCCGGGGG + Intronic