ID: 997404512

View in Genome Browser
Species Human (GRCh38)
Location 5:133634243-133634265
Sequence ATCCCTACACACACCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997404512_997404517 -3 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404517 5:133634263-133634285 GATGGGGTCACAGGTCTTTCTGG No data
997404512_997404518 -2 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404518 5:133634264-133634286 ATGGGGTCACAGGTCTTTCTGGG No data
997404512_997404519 2 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404519 5:133634268-133634290 GGTCACAGGTCTTTCTGGGATGG No data
997404512_997404521 7 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404521 5:133634273-133634295 CAGGTCTTTCTGGGATGGTTGGG No data
997404512_997404520 6 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404520 5:133634272-133634294 ACAGGTCTTTCTGGGATGGTTGG No data
997404512_997404522 20 Left 997404512 5:133634243-133634265 CCTTTGTTGGTGTGTGTAGGGAT No data
Right 997404522 5:133634286-133634308 GATGGTTGGGTGAAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997404512 Original CRISPR ATCCCTACACACACCAACAA AGG (reversed) Intergenic
No off target data available for this crispr