ID: 997405829

View in Genome Browser
Species Human (GRCh38)
Location 5:133645849-133645871
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997405829_997405837 13 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG No data
997405829_997405832 3 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405832 5:133645875-133645897 GCCCTCCGAACACCTTGAACTGG No data
997405829_997405838 14 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405838 5:133645886-133645908 ACCTTGAACTGGGACTAACTGGG No data
997405829_997405840 17 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405840 5:133645889-133645911 TTGAACTGGGACTAACTGGGTGG No data
997405829_997405834 4 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405834 5:133645876-133645898 CCCTCCGAACACCTTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997405829 Original CRISPR GCTCCCTCCAAAGGCTCTAG AGG (reversed) Intergenic
No off target data available for this crispr