ID: 997405831

View in Genome Browser
Species Human (GRCh38)
Location 5:133645858-133645880
Sequence GAGGGCCATGCTCCCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997405831_997405832 -6 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405832 5:133645875-133645897 GCCCTCCGAACACCTTGAACTGG No data
997405831_997405838 5 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405838 5:133645886-133645908 ACCTTGAACTGGGACTAACTGGG No data
997405831_997405840 8 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405840 5:133645889-133645911 TTGAACTGGGACTAACTGGGTGG No data
997405831_997405834 -5 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405834 5:133645876-133645898 CCCTCCGAACACCTTGAACTGGG No data
997405831_997405837 4 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997405831 Original CRISPR GAGGGCCATGCTCCCTCCAA AGG (reversed) Intergenic
No off target data available for this crispr