ID: 997405837

View in Genome Browser
Species Human (GRCh38)
Location 5:133645885-133645907
Sequence CACCTTGAACTGGGACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997405827_997405837 16 Left 997405827 5:133645846-133645868 CCTCCTCTAGAGCCTTTGGAGGG No data
Right 997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG No data
997405829_997405837 13 Left 997405829 5:133645849-133645871 CCTCTAGAGCCTTTGGAGGGAGC No data
Right 997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG No data
997405831_997405837 4 Left 997405831 5:133645858-133645880 CCTTTGGAGGGAGCATGGCCCTC No data
Right 997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997405837 Original CRISPR CACCTTGAACTGGGACTAAC TGG Intergenic
No off target data available for this crispr