ID: 997408676

View in Genome Browser
Species Human (GRCh38)
Location 5:133673214-133673236
Sequence TTGGGCCCCCAAAATCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997408676_997408683 17 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408683 5:133673254-133673276 AACTGAAAGCAGGCACTACAGGG No data
997408676_997408680 7 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408680 5:133673244-133673266 TCCTTTCACAAACTGAAAGCAGG No data
997408676_997408682 16 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408682 5:133673253-133673275 AAACTGAAAGCAGGCACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997408676 Original CRISPR TTGGGCCCCCAAAATCATTA AGG (reversed) Intergenic
No off target data available for this crispr