ID: 997408680

View in Genome Browser
Species Human (GRCh38)
Location 5:133673244-133673266
Sequence TCCTTTCACAAACTGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997408676_997408680 7 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408680 5:133673244-133673266 TCCTTTCACAAACTGAAAGCAGG No data
997408671_997408680 21 Left 997408671 5:133673200-133673222 CCAGCTTGAGTTTTCCTTAATGA 0: 4
1: 49
2: 60
3: 49
4: 246
Right 997408680 5:133673244-133673266 TCCTTTCACAAACTGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997408680 Original CRISPR TCCTTTCACAAACTGAAAGC AGG Intergenic
No off target data available for this crispr