ID: 997408682

View in Genome Browser
Species Human (GRCh38)
Location 5:133673253-133673275
Sequence AAACTGAAAGCAGGCACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997408678_997408682 -2 Left 997408678 5:133673232-133673254 CCCAAGGTATTTTCCTTTCACAA No data
Right 997408682 5:133673253-133673275 AAACTGAAAGCAGGCACTACAGG No data
997408679_997408682 -3 Left 997408679 5:133673233-133673255 CCAAGGTATTTTCCTTTCACAAA No data
Right 997408682 5:133673253-133673275 AAACTGAAAGCAGGCACTACAGG No data
997408671_997408682 30 Left 997408671 5:133673200-133673222 CCAGCTTGAGTTTTCCTTAATGA 0: 4
1: 49
2: 60
3: 49
4: 246
Right 997408682 5:133673253-133673275 AAACTGAAAGCAGGCACTACAGG No data
997408676_997408682 16 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408682 5:133673253-133673275 AAACTGAAAGCAGGCACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997408682 Original CRISPR AAACTGAAAGCAGGCACTAC AGG Intergenic
No off target data available for this crispr