ID: 997408683

View in Genome Browser
Species Human (GRCh38)
Location 5:133673254-133673276
Sequence AACTGAAAGCAGGCACTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997408679_997408683 -2 Left 997408679 5:133673233-133673255 CCAAGGTATTTTCCTTTCACAAA No data
Right 997408683 5:133673254-133673276 AACTGAAAGCAGGCACTACAGGG No data
997408678_997408683 -1 Left 997408678 5:133673232-133673254 CCCAAGGTATTTTCCTTTCACAA No data
Right 997408683 5:133673254-133673276 AACTGAAAGCAGGCACTACAGGG No data
997408676_997408683 17 Left 997408676 5:133673214-133673236 CCTTAATGATTTTGGGGGCCCAA No data
Right 997408683 5:133673254-133673276 AACTGAAAGCAGGCACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997408683 Original CRISPR AACTGAAAGCAGGCACTACA GGG Intergenic
No off target data available for this crispr