ID: 997409255

View in Genome Browser
Species Human (GRCh38)
Location 5:133678598-133678620
Sequence AAAATGAGCATGTCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997409255_997409259 18 Left 997409255 5:133678598-133678620 CCAGTTTTGGACATGCTCATTTT No data
Right 997409259 5:133678639-133678661 ACAAGTGGAGCTGTTGAATATGG No data
997409255_997409257 3 Left 997409255 5:133678598-133678620 CCAGTTTTGGACATGCTCATTTT No data
Right 997409257 5:133678624-133678646 ATGCCACTGAGGCATACAAGTGG No data
997409255_997409256 -8 Left 997409255 5:133678598-133678620 CCAGTTTTGGACATGCTCATTTT No data
Right 997409256 5:133678613-133678635 CTCATTTTGAGATGCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997409255 Original CRISPR AAAATGAGCATGTCCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr