ID: 997409590

View in Genome Browser
Species Human (GRCh38)
Location 5:133680945-133680967
Sequence CCCAGACCTGTGGGATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997409582_997409590 24 Left 997409582 5:133680898-133680920 CCTTGCTCTAGGTGATGCAGCTC No data
Right 997409590 5:133680945-133680967 CCCAGACCTGTGGGATTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997409590 Original CRISPR CCCAGACCTGTGGGATTCTG GGG Intergenic
No off target data available for this crispr